Concept explainers
The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.
1. an A-T base pair in the wild-type gene is changed to a G-C pair | a. transition |
2. an A-T base pair is changed to a T-A pair | b. base substitution |
3. the sequence AAGCTTATCG is changed to AAGCTATCG | c. transversion |
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG | d. deletion |
5. the sequence AACGTTATCG is changed to AATGTTATCG | e. insertion |
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG | f. deamination |
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG | g. X-ray irradiation |
h. intercalator | |
i. slipped mispairing |
1.
To determine:
The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When purines and pyrimidines are exchanged with each other, the process is called transition.
Answer to Problem 1P
Correct answer:
An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.
Explanation of Solution
In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.
2.
To determine:
The item that describes “an A-T base pair is changed to a T-A pair”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.
Answer to Problem 1P
Correct answer:
an A-T base pair is changed to a T-A pair: base substitution and transversion.
Explanation of Solution
In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.
3.
To determine:
The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.
Explanation of Solution
If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.
4.
To determine:
The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.
Answer to Problem 1P
Correct answer:
The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.
Explanation of Solution
Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.
5.
To determine:
The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.
Answer to Problem 1P
Correct answer:
the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.
Explanation of Solution
In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.
6.
To determine:
The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.
Answer to Problem 1P
Correct answer:
The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.
Explanation of Solution
In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.
7.
To determine:
The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.
Explanation of Solution
Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.
Want to see more full solutions like this?
Chapter 7 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Additional Science Textbook Solutions
Brock Biology of Microorganisms (14th Edition)
Evolutionary Analysis (5th Edition)
Principles of Anatomy and Physiology
Study Guide for Campbell Biology
Laboratory Experiments in Microbiology (11th Edition)
- You have a patient in your clinic presenting symptoms of cystic fibrosis. You screen their CFTR gene for mutations, and find the following list: CFTR 320 L V CFTR 341 S W CFTR 528 E D CFTR 976 F Q CFTR 1235 S R Which mutation(s) are likely causing cystic fibrosis in this patient? You also sequence a newborn family member of this patient. They have all of these same mutations, other than the one at position 976, and no other mutations in CFTR. Do you predict this person will develop cystic fibrosis? Explain why.arrow_forwardThere are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…arrow_forwardUse the sequences below to determine what type of mutation has occurred by comparing the normal sequence to the mutated sequence. Normal Gene Sequence: 3'- ATAGCTAAGCCCATGCGG-5' Mutated Gene Sequence 3'-ATAGCTAAGCCCAGGTGCGG-5' A. Deletion - Point Mutation B. Insertion - Chromosomal Mutation C. Deletion - Frameshift Mutation D. Substitution - Point Mutation E. Insertion - Frameshift Mutation F. Insertion - Point Mutationarrow_forward
- Which of the following examples is likely to be caused by asomatic mutation?A. A purple flower has a small patch of white tissue.B. One child, in a family of seven, is an albino.C. One apple tree, in a very large orchard, produces its apples 2weeks earlier than any of the other trees.D. A 60-year-old smoker develops lung cancer.arrow_forwardSuppose that a gene has a mutation that changes one nucleotide. Compared to the protein produced from the non-mutated gene, the protein produced from this mutated gene has one different amino acid. This newly altered protein provides enhanced resistance to tetracycline (an antibiotic). This type of mutation would be classified as a missense mutation. silent mutation. frameshift mutation. nonsense mutation. promutation.arrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forward
- The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forwardWhich of the following mutations would have the greatest negative impact on the protein product of a gene? A. a single base deletion close to the end of the coding region of a gene. B. a single base insertion near the start of the coding region of the gene C. a base-pair substitution D. a deletion of three bases near the middle of the genearrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forward
- Patient 1: a conservative missense mutation affecting amino acid 75 Patient 2: a synonymous mutation affecting amino acid 250 Patient 3: a nonsense mutation at amino acid 100. Patient 4: a 2 base-pair insertion after amino acid 352arrow_forwardWhat is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning