BIOLOGY: CONCEPTS&INVEST. (LL)
5th Edition
ISBN: 9781264706983
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 4MCQ
Choose the DNA sequence from which this mRNA sequence was
transcribed: 5'-AUACGAUUA-3'.
a. 3'-TATGCTAAT-5'
b. 3'-UTUGCUTIU-5'
c. 3'-UAUCGUAAU-5'
d. 3'-CTCAGCTIC-5'
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
f the template strand of DNA has the sequence 5’-TCTAGGACT-3’, what will the sequence of the transcribed RNA be?
A.
5’-AGAUCCUGA-3’
B.
5’-UCAGGAUCU-3’
C.
5’-AGUCCUAGA-3’
D.
5’-AGATCCTGA-3’
E.
5’-UCAGGATCT-3’
The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be
produced from transcribing this DNA template strand?
a. 5' - TATCGCATGTTCACCTAA - 3'
b.5' - UAUCGCAUGUUCACCUAA - 3'
c. 5' - AUGUUCACCUAA - 3'
d. 5' - UTGTTCUCCTUU - 3'
O e. 5' - AAUCCACUUGUACGCUAU - 3'
The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be
produced from transcribing this DNA template strand?
a. 5' - TATCGCATGTTCACCTAA - 3'
O b.5' - UAUCGCAUGUUCACCUAA - 3'
c. 5' - AUGUUCACCUAA - 3'
d. 5' - UTGTTCUCCTUU - 3'
e. 5' - AAUCCACUUGUACGCUAU - 3'
QUESTION 37
The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino
acids would be produced as a result of transcribing and translating this DNA template?
a. Met - Asn - Leu - Phe - His - [STOP]
Ob. Tyr - Arg - Met - Phe - Thr - [STOP]
O C. Asn - Pro - Leu - Val -
Arg - Tyr
d. Met - Phe - Thr - [STOP]
e. None of the above
O O O O
Chapter 7 Solutions
BIOLOGY: CONCEPTS&INVEST. (LL)
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 5WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 8WIOCh. 7 - Prob. 9WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - Prob. 11WIOCh. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Refer to the figure to answer these questions: a....Ch. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Prob. 17WIOCh. 7 - Parkinson disease causes rigidity, tremors, and...Ch. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Additional Science Textbook Solutions
Find more solutions based on key concepts
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
MARINE BIOLOGY
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Which of the following would be used to identify an unknown bacterial culture that came from a patient in the i...
Microbiology Fundamentals: A Clinical Approach
6. How can you use the features found in each chapter?
Human Anatomy & Physiology (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'arrow_forwardWhat is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 'arrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- Which of the following represents the sequence of an RNA transcript for which the template strand of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. DA. GUACUGGCUAGCUGCUAGAA B. UUCUAGCAGCUAGCCAGUAC с. ТТСТАGCAGCTAGCCAGTАС D. GTACTGGCТAGCTGCTAGAАarrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forward
- Use the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forwardWhat transcripts will be most affected by low levels of α- amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAsarrow_forwardWhy is the post-transcriptional polyA tail an important addition to a mRNA molecule? a.poly A tail is part of the protein translated from the mRNA b.poly A tail facilitates the binding of ribosomes c.3' tail signals the end of transcription by the RNA polymerase d.the tail adds stability to the transcript, controlling the time of degradation e.poly A tail facilitates the splicing of intronsarrow_forward
- Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1Aarrow_forwardA given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers providedarrow_forwardWhat mRNA is transcribed from each DNA sequen а. 5'-GTTCTAС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' c. 5'-GCCTAAGGCT-3' 3'- -5' d. 5'-CGCGCTTTGTG-3' 3'- -5'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY