BIOLOGY: CONCEPTS&INVEST. (LL)
5th Edition
ISBN: 9781264706983
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 7WIO
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy would extend to transcription and translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Some people compare DNA to a blueprint stored in the office of aconstruction company. Explain how this analogy would extend totranscription and translation.
You are sitting in Biology class and a classmate asks you to help them understand the process of translation. Using your own words, how would you explain the process to this student? Be detailed in your explanation
The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.
Chapter 7 Solutions
BIOLOGY: CONCEPTS&INVEST. (LL)
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 5WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 8WIOCh. 7 - Prob. 9WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - Prob. 11WIOCh. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Refer to the figure to answer these questions: a....Ch. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Prob. 17WIOCh. 7 - Parkinson disease causes rigidity, tremors, and...Ch. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Additional Science Textbook Solutions
Find more solutions based on key concepts
Describe the evolution of mammals, tracing their synapsid lineage from early amniote ancestors to true mammals....
Loose Leaf For Integrated Principles Of Zoology
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the genetic code used 4 bases at a time, how many amino acids could be encoded?arrow_forwardIf genes are discrete segments of DNA briefly describe how are they used as a template to synthesize a functional complementary RNA molecule.arrow_forwardExplain the ideas of transcription and translation using this picture.arrow_forward
- create a summary of the nucleotide pairs during the translation processarrow_forwardSelect the antisense strand of the DNA (opening at 3’ end from the left) and have it transcribed (RNA codons for translation). Translate the RNA codons using the given genetic code.arrow_forwardExplain how the DNA code is used to create a protein. Highlight each step in the processarrow_forward
- What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value.arrow_forwardUsing the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.arrow_forwardA genetic code in which two bases encode a single amino acid is not adequate for protein synthesis. Give a reason why.arrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardDNA mutations can affect the reading frame for the genetic code. What is a human condition caused by these mutations? Identify how the reading frame is affected.arrow_forwardA) Describe each step of the DNA REPLICATION in EUKARYOTIC organismsB) Describe each step of the TRANSCRIPTION in EUKARYOTIC organisms.C) Describe each step of the TRANSLATION. Please answer all if you can! thank youarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license