BIOLOGY: CONCEPTS AND INVESTIGATIONS,
5th Edition
ISBN: 9781266382307
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 5MCQ
Summary Introduction
Introduction:
A codon is a specific sequence of
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
8.) Answer the following questions regarding the following DNA
sequence.
3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5"
A.)
What is the MRNA sequence that would result from transcription of this
sequence? Assume that the DNA would be read from left to right.
What is the amino acid sequence that would result from translation of
B.)
the MRNA resulting from the sequence? See Codon Table on next page.
20
C.) What is the anti-codon found on the tRNA that would deliver the amino
acid for the first codon in the MRNA sequence?
D.) If the fourth nucleotide in the DNA sequence were deleted due to a
mutation during DNA replication, what would the resulting amino acid
sequence be? What type of mutation is this?
E.) What impact would the mutation in the DNA sequence in PART D have
on the function of the protein produced from original sequence? Why?
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? *
A. Asparagine- Histidine
B. Lysine -Serine
C. Aspartic Acid - Histidine
D. Lysine-Glysine
Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? *
A. Deletion-Frameshift
B. Insertion- frameshift
C. Substitution-Deletion
D. Substitution-Insertion
Which of the following types of RNA is involved in the transcription phase of protein synthesis? *
A. rRNA
B. tRNA
C. hnRNA
D. no correct response
A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? *
A. 5' AAG 3
B. 5' CUU 3'
C. 3' GAA 5'…
Chapter 7 Solutions
BIOLOGY: CONCEPTS AND INVESTIGATIONS,
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 5WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 8WIOCh. 7 - Prob. 9WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - Prob. 11WIOCh. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Refer to the figure to answer these questions: a....Ch. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Prob. 17WIOCh. 7 - Parkinson disease causes rigidity, tremors, and...Ch. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Define the following terms: a. open reading frame b. degenerate coding system c. nonoverlapping coding sequence d. codon e. anticodonarrow_forwardConsider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward
- Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code c. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon g. Nonsense codon h. Universal code i. Nonuniversal codons 6. How is the reading frame of a nucleotide sequence set?arrow_forwardThe AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracyarrow_forwardFor each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA). a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. b. Is a major component of ribosomes. c. Specifies the order of amino acids in a protein, using a series of three-base codons, where different amino acids are specified by particular codons. d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. e. Assists in making the bonds that link amino acids together to make a protein.arrow_forward
- Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U G G G C U U U... beginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? A) Thr-Met- Gly B) Met-Gly-Phe C) Ser-Asp-Gly-Leu .arrow_forwardCompare the severity of DNA mutations that produce the following changes in mRNA codons:(a) GCU to GCC (b) ACU to AUUarrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardDNA mutations can affect the reading frame for the genetic code. What is a human condition caused by these mutations? Identify how the reading frame is affected.arrow_forwardA small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine basearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license