CONCEPTS OF BIO LAB MAN W/ CONNECT >CI<
4th Edition
ISBN: 9781307429008
Author: Hoefnagels
Publisher: MCG/CREATE
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 6MCQ
Summary Introduction
Introduction:
Translation is a process in which protein is synthesize from after transcription of DNA into RNA. Protein synthesis occurs in nucleus of cell. Ribosome which is present in cytoplasm or endoplasmic reticulum is involves in protein synthesis. The process of protein synthesis is also known as gene expression.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the role of transcription in the determination of the amino acid sequence of a polypeptide chain?
A.
It pairs anticodons and codons.
B.
It synthesizes an mRNA strand.
C.
It duplicates the information in DNA.
D.
It decodes the information from mRNA.
a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends.
b. translate this RNA sequence in 1a into a protein sequence
c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends.
d. Translate this RNA sequence in 1c into a protein sequence
A scientist isolates some mRNA from one gene and compares its sequence to that of the gene from which it was copied. Where will the mRNA be found to end?
A. at the promoter
B. at an intron
C. at the stop codon
D. at an enhancer
Chapter 7 Solutions
CONCEPTS OF BIO LAB MAN W/ CONNECT >CI<
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 5WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 8WIOCh. 7 - Prob. 9WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - The amount of melanin in the skin is controlled by...Ch. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - Refer to the figure to answer these questions: a....Ch. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Parkinson disease causes rigidity, tremors, and...Ch. 7 - Prob. 18WIOCh. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one of the standard bases c. Encoded by rare bases in DNA d. Encoded by sequences in intronsarrow_forwardWhich statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b) Translation begins at the start of the 5' UTR c) The 5' and 3' UTRs are spliced from the mRNA transcript d) The translation stop codon is found downstream of the 3' UTRarrow_forwardUse the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?arrow_forward
- Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.arrow_forwardRefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forwardWhich is true of the lagging strand in DNA synthesis? a. It is built elongating towards the replication fork b. It is composed entirely of RNA c. It is built in the 3’ to 5’ direction d. It elongates in a series of segments, rather than continuouslyarrow_forward
- How do we call the type of point mutation in which an A->U change occurs in the codon for the sixth amino acid in hemoglobin chain b? a) Inversion b) Transversion c) Transition d) Transaminationarrow_forwardWhich rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A. 28S rRNA B. 23S rRNA C. 16S rRNA D. 18S rRNAarrow_forwardGive typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.arrow_forward
- Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars would not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing proteinarrow_forwardTreating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars woulf not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing protein.arrow_forwardWhat is the genetic code? a. The relationship between a three-base codon sequence and an amino acid or the end of translation b. The entire base sequence of an mRNA molecule c. The entire sequence from the promoter to the terminator of a gene d. The binding of tRNA to mRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY