BIOLOGY
4th Edition
ISBN: 9781266739606
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7.8, Problem 2MC
What insights could scientists gain by intentionally mutating the FOXP2 gene in a developing human? Would such an experiment be ethical?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
What are some of the ethical concerns arising out of the information produced by the Human Genome Project?
You just graduated from college and started working at a biotech startup called Scrofabulous. Your
first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene
for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and
economical first step to go about identifying and cloning the pig gene for prolactin?
use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers
to PCR-amplify the pig prolactin gene.
RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin
Conduct a proteome search for peptides that match parts of mouse prolactin protein
Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin
Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid
sequence in the pig proteome
Briefly describe the creation of a transgenic mouse in your lab.
Chapter 7 Solutions
BIOLOGY
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 5WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 8WIOCh. 7 - Prob. 9WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - The amount of melanin in the skin is controlled by...Ch. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - Refer to the figure to answer these questions: a....Ch. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Parkinson disease causes rigidity, tremors, and...Ch. 7 - Prob. 18WIOCh. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Additional Science Textbook Solutions
Find more solutions based on key concepts
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
Human Anatomy
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
Which of the following would be used to identify an unknown bacterial culture that came from a patient in the i...
Microbiology Fundamentals: A Clinical Approach
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
Marine Biology (Botany, Zoology, Ecology and Evolution)
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardLet’s suppose you are in charge of organizing and publicizing a databasefor the mouse genome. Make a list of innovative strategies you wouldinitiate to make the mouse genome database useful and effective.arrow_forwardHow can gene knockouts, transgenic animals, and geneeditingtechniques be used to explore gene function?arrow_forward
- What ethical issues may be associated with human cloning?arrow_forwardFor what reasons would gene therapy be more effective performed onembryos rather than fully developed animals?arrow_forwardSuppose that you have just graduated from college and have started working at a biotechnology firm. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; however, the mouse gene for prolactin has been cloned, and the amino acid sequence of mouse prolactin is known. Briefly explain two different strategies that you might use to find and clone the pig gene for prolactin.arrow_forward
- What is a chimera and how is it different from a “true transgenic animal”?arrow_forwardIt has been suggested that it would make the study of human diseases easier if cloned transgenic animals were produced that carried faulty versions of human genes (e.g., the gene that causes cystic fibrosis). a. Why would such animals be useful in medical research? : b. What ethical questions are raised by the creation of such transgenic animals?arrow_forwardWhat was used in experiments to induce mutations in Drosophila in the 1920s? What is Drosophila? Search online. X-rays was used in the experiment To induce mutationsarrow_forward
- You have managed to create a personal PCR fragment containing a human olfactory receptor gene in an attempt to answer that question that's been haunting you for years--whether or not your dog has any olfactory (sense of smell) genes that may be related to yours. Explain how you can use your fragment, along with the genomic DNA from your dog, to answer your question.arrow_forwardhttps://ny.pbslearningmedia.org/resource/biot09.sci.life.gen.epigenetics/epigenetics/ In what way do the brown and yellow mice shown in the video differ?Why is this so?arrow_forwardThere are a range of ethical issues associated with cloning. However, many of these are not applied to cloning plants. Explain why the idea of cloning an entire plant is generally accepted while cloning an entire human is not.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY