Microbiology: An Introduction (13th Edition)
13th Edition
ISBN: 9780134605180
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case, Derek Weber, Warner Bair
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 4R
The following is a code for a strand of DNA.
- a. Using the genetic code provided in Figure 8.8, fill in the blanks to complete the segment of DNA shown.
- b. Fill in the blanks to complete the sequence of amino acids coded for by this strand of DNA.
- c. Write the code for the complementary strand of DNA completed in part (a).
- d. What would be the effect if C were substituted for T at base 10?
- e. What would be the effect if A were substituted for G at base 11?
- f. What would be the effect if G were substituted for T at base 14?
- g. What would be the effect if C were inserted between bases 9 and 10?
- h. How would UV radiation affect this strand of DNA?
- i. Identify a nonsense sequence in this strand of DNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Refer to Figure 2 and compare this with the DNA model in Figure 1.
a. In what ways are they similar?
b. In what ways are they different?
c. What is the biological significance of such differences? Why is the DNA referred to as the genetic material?
If a virus particle contained double-stranded B-DNA of 400,000 base pairs,
A. How many complete helical turns would occur on each strand?
B. How many atoms of phosphorus would be present?
C. If the mole % of G in this genome is 17%, what is the mole % of A?
The following diagram of a generalized tetranucleotide will serve as a basis for the three questions marked “a” through “c.” (02)
(a) Is this a DNA or an RNA molecule? State which _________
(b) Place an “X” (in one of the circles provided) at the 3' end of this tetranucleotide.
(c) Given that the DNA strand, which served as a template for the synthesis of this tetranucleotide, was composed of the bases 5'- A C A G - 3', fill in the parentheses (in the diagram) with the expected bases
Chapter 8 Solutions
Microbiology: An Introduction (13th Edition)
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Prob. 5RCh. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...
Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (2nd Edition)
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (3rd Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardGiven the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?arrow_forwardGive the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forward
- The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwardIn the figure, which phosphate group will remain after this nucleotide is added to a growing DNA strand?arrow_forwardIn proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. What does Chargaff’s rules mean? Who proposed DNA was a double helix? In what decade? If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? When DNA replicates, how is it able to “unwind” its double helix?arrow_forward
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardWhich is a difference between B-DNA and A-DNA? A. For polynucleotide strands containing the same number of nucleotides, the B-DNA strand will be shorter from end-to-end than the corresponding A-DNA. B. Both are helical, but B-DNA is right-handed and A-DNA is left-handed. C. The sugar in A-DNA is more oxidized than that in B-DNA D. Helical structures in RNA predominantly adopt the B-DNA conformation. E. None of the above. The tetranucleotide AGTC (in DNA) has a free hydroxyl group on ____. A. A B. G, T, and C C. C D. A, G, T, and Carrow_forwardthe human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During infection, however, HIV uses an enzyme known as reverse transcriptase to generate double-stranded DNA. Generally speaking, how would the enzyme generate a double strand of DNA from a single strand of RNA?arrow_forward
- Which of the following describes a Z-DNA helix? a. It is inhibited by methylation of bases b. It is favored by alternating GC sequence c. It has fewer base pairs per turn than the B-DNA d. It is favored in many solutions that are relatively devoid of waterarrow_forwardWrite the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3 'b. 5 '–ACTGGACT–3 'c. 5 '–CGATATCCCG–3 'd. 5 '–TTCCCGGGATA–3arrow_forwardIf you had a protein that developed a mutation that changed its TEMPLATE strand from 5’GAT 3’ to 5’AAT3’ What amino acid would you expect in the normal protein, and what would you find in the mutant?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY