Biology: The Unity and Diversity of Life
15th Edition
ISBN: 9780357093795
Author: STARR
Publisher: CENGAGE LEARNING (CUSTOM)
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9, Problem 13SQ
Summary Introduction
Introduction: Transcription is the process in which the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be?
I chose b and got this questions wrong, why is this wrong?
a.
The mRNA would not properly exit the nucleus.
b.
The mRNA would not properly bind to a ribosome.
c.
The mRNA would not receive a poly A tail.
d.
The mRNA would not use the correct start codon.
e.
Both a and b are correct.
Which of the following is an example of a transcription factor?
A) gene
B) a repressor
C) a ribosome
D) an intron
In ________, transcription and translation occur simultaneously.
a.
prokaryotes
b.
both prokaryotes and eukaryotes
c.
eukaryotes
Chapter 9 Solutions
Biology: The Unity and Diversity of Life
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only eukaryotes contain a large subunit. b. both contain the same number of proteins. c. both use mRNA to assemble amino acids into proteins. d. both contain the same number of types of rRNA. e. both produce proteins that can pass through pores into the nucleus.arrow_forwardFor eukaryote cells to evolve into new types of eukaryotic organism, which of the following would one expect to occur? a) All the cells are identical b) The endoplasmic reticulum is not involved. c) These specialized cells activate only the genes in their nucleoid area. d) Cells must be getting new genetic mutations and more DNA e) none of these are true.arrow_forwardBelow is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’arrow_forward
- The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start sitearrow_forwardSpontaneous mutations a happen when the cell is exposed to UV light b happen when the cell is exposed to chemicals c happen during the normal operation of the cell d none of the abovearrow_forwardTransfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information from the DNA to the ribosome c. Helps make up the ribosome d. Carries oxygen to cellsarrow_forward
- how does eukaryotic ribosome find the mRNA to be translated? A. the sigma factor B. the shine-Dalgarno sequence C. the Inr sequence D. the 5'caparrow_forwardWhich of the following is true of ribosome rescue? (C & E wrong) A. The process produces a protein that is tagged for degradation. B. Proteases enter the A-site of the ribosome to degrade the C-terminus of the synthesized peptide. C. A partially translated mRNA becomes fully degraded before it can be translated further. D. No protein is produced in the process. E. Stalled ribosomes are released in the absence of a stop codon.arrow_forwardThe anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.arrow_forward
- Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made up of only introns c. it is constructed from mRNA that is reverse transcribed d.arrow_forwardThe 40S and 60S subunits combine to form the eukaryotic _______ ribosome? a. 60S b. 70S c. 80S d. None of the abovearrow_forwardIn bacteria the ribosome is positioned next to the start codon by A the ribosome binding site B a promoter C by scanning for a correct start codon D none of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license