Biology: The Unity and Diversity of Life
15th Edition
ISBN: 9780357093795
Author: STARR
Publisher: CENGAGE LEARNING (CUSTOM)
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 7SQ
Summary Introduction
Introduction: DNA is double-stranded consisting of two anti-parallel strands of nucleotides. Both strands run in 5′-3′ direction and are held by the hydrogen bonds between
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
The replication of chromosomes by eukaryotes occurs in a relatively short period of time because ?
a. The eukaryotes have more amount of DNA for replication
b. The eukaryotic replication machinery is 1000 times faster than prokaryotes
c. Each chromosome contains multiple replicons di ba ito? Same eto
d. Eukaryotic DNA is always DNA stranded
Addition or deletion of bases causes which kind of mutation?
Select one:
a.
Frameshift mutation
b.
Transversion
c.
Transition
d.
Transcription
Chapter 9 Solutions
Biology: The Unity and Diversity of Life
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Cytochrome C Study A scientist wants to study the cytochrome c gene of a fruit fly. The DNA for the gene is extracted and subjected to several treatments. Use the passage to answer the next four questions. Part A: During cloning, the DNA is cut with a restriction enzyme giving it what? A. more introns B. sticky ends C. a polyA tail D. a binding site for a transcription factor Part B: If the scientist wanted to have a large number of copies of the gene for use in further study, which technique would the scientist use? A. PCR B. epigenetics C. hybridization D. gel electrophoresis Part C: If this gene were found to be expressed at different levels in different cells of the same organism, what would be responsible? A. transcription factor B. rRNA C. ribosome D. RNA polymerasearrow_forwardCytochrome C Study A scientist wants to study the cytochrome c gene of a fruit fly. The DNA for the gene is extracted and subjected to several treatments. Use the passage to answer the next four questions. Part A: During cloning, the DNA is cut with a restriction enzyme giving it what? A. more introns B. sticky ends C. a polyA tail D. a binding site for a transcription factor Part B: If the scientist wanted to have a large number of copies of the gene for use in further study, which technique would the scientist use? A. PCR B. epigenetics C. hybridization D. gel electrophoresis Part C: If this gene were found to be expressed at different levels in different cells of the same organism, what would be responsible? A. transcription factor B. rRNA C. ribosome D. RNA polymerase Part D: If a disease were identified as being caused by defects in the cytochrome c gene, then the copy isolated could be…arrow_forwardUse your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutationarrow_forward
- DNA is the cellular repository of genetic information, andproteins are synthesized from RNA transcripts. Why don’tcells simply skip the transcription step and use DNA directlyin protein synthesis?arrow_forwardDNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new strands in both direction d. seal gaps in the sugar-phosphate backbone e. catalyze carbon bondingarrow_forwardProcess by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)Transesterificationarrow_forward
- DNA replication begins... A. At the origin of replication B. At the 5' end of the DNA strand C. At the centromeres where sister chromatids are connected D. At the start codonarrow_forwardIn Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardAfter transcription, the molecule that is formed is a.complementary to part of one strand of DNA. b.complementary to both strands of DNA. c.double-stranded and inside the nucleus. d.identical to an entire single strand of DNA.arrow_forward
- Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forwardRepair enzymes _____. a. repair only mutations that occur in mitochondrial DNA b. can only repair mutations that occur prior to replication c. can only repair mutations that occur after replication d. repair only DNA mismatch mutations e. repair only mutations that arise during replicationarrow_forwardFollowing transcription, the RNA has a complementary sequence of which of the following?Question 9 options: A) regulatory sequences B) termination sequences in the coding strand of DNA C) the template strand of DNA D) none of the answers are correctarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license