Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337670319
Author: STARR
Publisher: Cengage
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 15SQ
Match the terms with the best description.
______ | genetic message | a. protein-coding segment |
______ | promoter | b. transcription begins here |
______ | polysome | c. read as base triplets |
______ | exon | d. removed before translation |
______ | genetic code | e. occurs only in groups |
______ | intron | f. 64 codons |
______ | anticodon | g. destroys ribosomes |
______ | RIP | h. often causes a frameshift |
______ | deletion | i. enzymatic RNA |
______ | rRNA | j. binds to a codon |
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
If a codon found in the mRNA sequence Tessa CGA, the tRNA anticodon that would bind to that codon region would read...
A. CGT
b. GCU
c. UCG
d. GCT
The tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to GAA. What happens to the cell? Select the best answer. Please note that all nucleic acid sequences are provided according to scientific convention.
a.
All UUU codons now code for Glu instead of Phe
b.
All UUU codons now code for Leu instead of Phe
c.
Nothing happens
d.
All AAA codons now code for Glu instead of Phe
e.
All AAA codons now code for Leu instead of Phe
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT
a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why is it unlikely that two neighboring water molecules would be arranged like this?
Campbell Biology (10th Edition)
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
Human Anatomy
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
Some species of bacteria that live at the surface of sediment on the bottom of lakes are capable of using eithe...
Biology: Life on Earth with Physiology (11th Edition)
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forward_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acidsarrow_forwardLABEL IMAGE WITH THESE TERMS TRANSCRIPTION DNA MRNA AND PROTEIN ALSO CIRCLE EACH CODONarrow_forward
- Match the terms with the best description.____ genetic message a. protein-coding segment____ promoter b. transcription begins here____ polysome c. read as base triplets____ exon d. removed before translation____ genetic code e. occurs only in groups____ intron f. 64 codons____ anticodon g. destroys ribosomes____ RIP h. often causes a frameshift____ deletion i. enzymatic RNA____ rRNA j. binds to a codonarrow_forwardWhich of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop codon d. AUG codonarrow_forwardA. rRNA is used to transfer amino acids to the ribosome. make up the large ribosomal subunit. make up the subunits of a ribosome. make up the small ribosomal subunit. B. When the full ribosome has bound to mRNA for the first time, the first codon (start codon) of the mRNA is in which site? It varies. P E Aarrow_forward
- A protein had the amino acids leu-gly at codons 10 and 11. A deletion of the 5’ base of the leu codon (i.e. the first base) changed the protein so that it now reads ser-ala at codons 10 and 11. The original Leu codon must have been: (hint: make use of a codon table to answer this question) CUG AUG CUA CUC CUUarrow_forwardWhich of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that comprises the transfer RNA b) mRNA transcript just after transcription c) polypeptide chain released by ribosome d) mRNA transcript that a ribosome attaches toarrow_forwardPlease answer the following questions, no need to explain each choices just explain the correct answer. 1. Which of the following has only one equivalent codon? A) Ala B) Arg C) Val D) Trp E) Gly 2. Which of the following does not describe transcription? A) Synthesis of RNA using DNA as the template B) Requires DNA-dependent RNA Pol C) Highly selective process that is strictly regulated D) A step in gene expression E) None of the abovearrow_forward
- During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric shift occurs (c) a peptide bond forms (d) anticodon and codon pairing occurs (e) all of the abovearrow_forwardIf an mRNA codon reads UAC, its complementary anticodon will bea. TUC.b. ATG.c. AUG.d. CAGarrow_forward3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY