Biology: The Unity and Diversity of Life (MindTap Course List)
Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337670319
Author: STARR
Publisher: Cengage
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 9, Problem 9SQ
Summary Introduction

Introduction: Transcription is the process in which the nucleotide sequences of a gene are transcribed into mRNA sequences, which code for proteins. During the process, RNA polymerase enzyme catalyzes the synthesis of phosphodiester bonds between RNA nucleotides, and thus mRNA chain extends by one nucleotide at a time.

Blurred answer
Students have asked these similar questions
Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?
A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above.  Write the mature mRNA strand after the three modifications?   b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY