Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337670319
Author: STARR
Publisher: Cengage
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 14SQ
Energy that drives translation is provided mainly by ___ .
- a. ATP
- b. amino acids
- c. CTP
- d. all of the above
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
Energy that drives translation is provided mainly by______ . a. ATP c. GTP b. amino acids d. all of the above
1. Translation
a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Additional Science Textbook Solutions
Find more solutions based on key concepts
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual for Holes Human Anatomy & Physiology Fetal Pig Version
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus (2nd Edition)
Visit this site (http://openstaxcollege.org/l/heartvalve) to observe an echocardiogram of actual heart valves o...
Anatomy & Physiology
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?arrow_forwardA term for the coding region of DNA is: ?? (Group of answer choices) A.a nucleotide B. an exon C.an intron D.a codon E. an allele.arrow_forwardDuring Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric shift occurs (c) a peptide bond forms (d) anticodon and codon pairing occurs (e) all of the abovearrow_forward
- _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acidsarrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
- If a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.arrow_forwardWhich two sequences shown in the diagram are NOT directly transcribed from the template strand of DNA for this mRNA? ( select all that apply) a) The exons b) 5' cap c) 3' poly-A tail d) UGA e) AUGarrow_forwardBelow is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’arrow_forward
- Which of the following are involved in transcription?Select all that apply a. rRNA b. DNA c. acetyl transferase d. tRNA e. ribosome f.a mino acids g. RNA polymerase h. mRNAarrow_forwardSection a) have already answered and the rest of the problems tobe answerd. a) what is the genetic code and explain the properties b) list the difference between eukaryotic and prokaryotic translation initiation c) explain the role E.coli translation elongation factors.arrow_forwardNow imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A T G A T C This would be an example of which type of a point mutation?__________________________arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license