Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 9, Problem 28P
Summary Introduction
To analyze:
Several examples of the Shine-Dalgarno sequence are present in Figure
Introduction:
Consensus sequences are a short stretch of DNA sequences that are commonly located
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Find self-complementary regions in the following RNA sequence:
AUGUGGCAUGCCAGG
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted.
5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give all possible codons with which each tRNA can pair.
Q. 5′ –AAG–3′
Chapter 9 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 9 - 9.1 Some proteins are composed of two or more...Ch. 9 - In the experiments that deciphered the genetic...Ch. 9 - 9.3 Several lines of experimental evidence pointed...Ch. 9 - Outline the events that occur during initiation of...Ch. 9 - 9.5 A portion of a DNA template strand has the...Ch. 9 - Describe three features of tRNA molecules that...Ch. 9 - Prob. 7PCh. 9 - For each of the anticodon sequences given in the...Ch. 9 - What is the role of codons UAA, UGA and UAG in...Ch. 9 - Compare and contrast the composition and structure...
Ch. 9 - Consider translation of the following mRNA...Ch. 9 - Prob. 12PCh. 9 - Third-base wobble allows some tRNAs to recognize...Ch. 9 - The genetic code contains 61 codons to specify the...Ch. 9 - 9.15 The three major forms of (,, and ) interact...Ch. 9 - The accompanying figure contains sufficient...Ch. 9 - 9.17 The line below represents a mature eukaryotic...Ch. 9 - 9.18. After completing Problem, carefully draw a...Ch. 9 - 9.19 Define and describe the differences in the...Ch. 9 - 9.20. Describe the roles and relationships...Ch. 9 - 9.21 In an experiment to decipher the genetic...Ch. 9 - Identify and describe the steps that lead to the...Ch. 9 - Prob. 23PCh. 9 - Har Gobind Khorana and his colleagues performed...Ch. 9 - 9.25 An experiment by Khorana and his colleagues...Ch. 9 - Prob. 26PCh. 9 - 9.27 The mature transcribed from the human gene is...Ch. 9 - Prob. 28PCh. 9 - Prob. 29PCh. 9 - Prob. 30PCh. 9 - 9.31 A portion of the coding strand of for a gene...Ch. 9 - A eukaryotic mRNA has the following sequence. The...Ch. 9 - Diagram a eukaryotic gene containing three exons...Ch. 9 - Prob. 34PCh. 9 - 9.35 Table lists and gene sequences for or ...Ch. 9 - Prob. 36PCh. 9 - In terms of the polycistronic composition of mRNAs...
Knowledge Booster
Similar questions
- Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?arrow_forwardThere are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?arrow_forwardFor each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon table as needed. 5'-AUU-3' anticodon: 3'- -5' amino acid: 5' -UCU-3' anticodon: 3'- -5' amino acid: 5' -CAG-3' anticodon: 3'- -5' amino acid:arrow_forward
- Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U U A UUU UUC- UUA UUG- CUU CUC CUA CUG- U Phe (F) Leu (L) Leu (L) Second base in codon Val (V) UCU - UCC UCA UCG CCU CCC CCA CCG AUU ACU- AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU- GUC GCC GUA GCA GUG GCG- C Ser (S) Pro (P) Thr (T) Ala (A) UAU UAC UAAT UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A Tyr (Y) STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) Cys (C) CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU- GGC GGA GGG Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Last base in codonarrow_forwardThe sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEarrow_forwardConsider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence 2: GCG GAG AAA UGG UAU Draw an anti-parallel b-sheet that can be formed between the amino acids from the two codon sequences.arrow_forward
- Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequencesarrow_forwardThe 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the Shine–Dalgarno sequence and the initiator codon.5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′arrow_forwardSeveral experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra aminoacids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.arrow_forward
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forwardThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'arrow_forwarda) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning