Genetic Analysis: An Integrated Approach (2nd Edition)
Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
Question
Book Icon
Chapter 9, Problem 12P
Summary Introduction

To analyze:

The following diagram of a eukaryotic ribosome contains several errors.

Genetic Analysis: An Integrated Approach (2nd Edition), Chapter 9, Problem 12P

  1. Examine the diagram carefully, and each error is to be identified.

  2. Redraw the diagram, and using the mRNA sequence each error is to be corrected.

Introduction:

Ribosome is one of the essential organelles in the cell that carries out protein synthesis. Since bacteria do not have membrane bound organelles, the ribosomes float in the cytoplasm. Ribosome it is complex of protein and rRNA, and it is made up of 2 subunits- large and small. It decodes the genetic message into proteins.

Translation is the process of production of proteins by mRNA decoding. The crucial step in protein synthesis is peptidyl transfer, i.e., newly synthesized amino acids are attached with peptide bonds that are transferred from one tRNA molecule to the next. These amino acids have specific codons, and all these amino acids synthesize polypeptide chain.

Prokaryotes have 70S ribosome- 50S & 30S are subunits of it. Eukaryotes have 80S ribosome- smaller 40S subunit and larger 60S. There are complete 4 binding sites on Ribosome – one for mRNA and three for tRNA. Ribosomal larger subunit has 3 sites for amino acid synthesis – E, P, A.

Blurred answer
Students have asked these similar questions
Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylation
Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'
Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’   Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning.  What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:

Chapter 9 Solutions

Genetic Analysis: An Integrated Approach (2nd Edition)

Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning