Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 5P
A portion of a DNA template strand has the base sequence
a. Identify the sequence and polarity of the mRNA transcribed from this fragmentary template strand sequence.
b. Assume the mRNA is written in the correct reading frame. Determine the amino acid sequence encoded by this fragment. Identify the N- and C-terminal directions of the polypeptide.
c. Which is the third amino acid added to the polypeptide chain?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The template strand of a segment of double-helical DNA contains the sequence –
5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’
a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends.
b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends.
c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA
a. predict the compliment strand of dna (coding strand)
b. predict the transcribed product of the coding strand (mRNA transcript)
c. given the genetic code table, predict the amino acid sequence of the transcript
d. predict the amino acid sequence if the A underlined became deleted
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above.
Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Chapter 9 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 9 - 9.1 Some proteins are composed of two or more...Ch. 9 - In the experiments that deciphered the genetic...Ch. 9 - 9.3 Several lines of experimental evidence pointed...Ch. 9 - Outline the events that occur during initiation of...Ch. 9 - 9.5 A portion of a DNA template strand has the...Ch. 9 - Describe three features of tRNA molecules that...Ch. 9 - Prob. 7PCh. 9 - For each of the anticodon sequences given in the...Ch. 9 - What is the role of codons UAA, UGA and UAG in...Ch. 9 - Compare and contrast the composition and structure...
Ch. 9 - Consider translation of the following mRNA...Ch. 9 - Prob. 12PCh. 9 - Third-base wobble allows some tRNAs to recognize...Ch. 9 - The genetic code contains 61 codons to specify the...Ch. 9 - 9.15 The three major forms of (,, and ) interact...Ch. 9 - The accompanying figure contains sufficient...Ch. 9 - 9.17 The line below represents a mature eukaryotic...Ch. 9 - 9.18. After completing Problem, carefully draw a...Ch. 9 - 9.19 Define and describe the differences in the...Ch. 9 - 9.20. Describe the roles and relationships...Ch. 9 - 9.21 In an experiment to decipher the genetic...Ch. 9 - Identify and describe the steps that lead to the...Ch. 9 - Prob. 23PCh. 9 - Har Gobind Khorana and his colleagues performed...Ch. 9 - 9.25 An experiment by Khorana and his colleagues...Ch. 9 - Prob. 26PCh. 9 - 9.27 The mature transcribed from the human gene is...Ch. 9 - Prob. 28PCh. 9 - Prob. 29PCh. 9 - Prob. 30PCh. 9 - 9.31 A portion of the coding strand of for a gene...Ch. 9 - A eukaryotic mRNA has the following sequence. The...Ch. 9 - Diagram a eukaryotic gene containing three exons...Ch. 9 - Prob. 34PCh. 9 - 9.35 Table lists and gene sequences for or ...Ch. 9 - Prob. 36PCh. 9 - In terms of the polycistronic composition of mRNAs...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardBriefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAarrow_forwardA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forward
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardA peptide sequence is composed of 10 serine residues. Determine how many different mRNA sequences could code for the peptide.arrow_forward
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…arrow_forwardA particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The corresponding codon for the mRNA is _________ (write 5’ --> 3). B. If this codon is translated, the codon specifies the addition of which amino acid? _______________________arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)arrow_forwardA polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA bases required to code for the amino acids in this polypeptide. Show your calculation. (ii) Does AUG appear in the first three nucleotides in the mRNA coding for this mRNA? Explain why.arrow_forwardHere is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY