Concept explainers
For each of the restriction enzymes listed below: (i) Approximately how many restriction fragments would result from digestion of the human genome (3 × 109 bases) with the enzyme? (ii) Estimate the average size of the pieces of the human genome produced by digestion with the enzyme. (iii) State whether the fragments of human DNA produced by digestion with the given restriction enzyme would have sticky ends with a 5′ overhang, sticky ends with a 3′ overhang, or blunt ends. (iv) If the enzyme produces sticky ends, would all the overhangs on all the ends produced on all fragments of the human genome with that enzyme be identical, or not? (The recognition sequence on one strand for each enzyme is given in parentheses, with the 5′ end written at the left. N means any of the four
a. | Sau3A (^GATC) |
b. | BamHI (G^GATCC) |
c. | HpaII (C^CGG) |
d. | SphI (GCATG^C) |
e. | NaeI (GCC^GGC) |
f. | BanI (G^GYRCC) |
g. | BstYI (R^GATCY) |
h. | BslI (CCNNNNN^NNGG) |
i. | SbfI (CCTGCA^GG) |
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 9 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
- A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.arrow_forwardWhen joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…arrow_forwardRestriction endonucleases (RE) are one of the most used enzymes in biotechnology for recombinant DNA experimentations. These enzymes consist of three major classes; I, II and III. (i) Why is RE Class II commonly utilized in the labs as compared to Class I and III? (ii) Why is RE referred as Restriction Endonuclease and not Restriction Exonuclease? (iii) Some REs are known as isoschizomers. Describe isoschizomers with an example.arrow_forward
- The figure below shows the recognition sequences and cleavage positions of three restriction enzymes.You plan to ligate DNA from two different sources. The target DNA is digested with BamHI,and the insert DNA is digested with BglII, and the resulting fragments mixed and incubatedwith DNA ligase. a) Write out the sequence (in double-stranded format) of the longest insert fragment that will result after BglII digestion, ensure the nature of the overhangs is clear.b) Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. c) Assume the ligation reaction was successful and you have generated a recombinant DNAmolecule. Which of the three enzymes listed above can be used to excise the insert DNAfrom the target? Motivate your answer.arrow_forwardA linear piece of DNA that is 14 kb long is cut first by EcoRI alone, then by SmaI alone, and finally, by both EcoRI and SmaI together. The following results are obtained: Draw a map of the EcoRI and SmaI restriction sites on this 14-kb piece of DNA, indicating the relative positions of the restriction sites and the distances between them.arrow_forwarda)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer presentarrow_forward
- If the sequence of base pairs along a DNA molecule occurs strictly at random, what is the expected frequency of a specific restriction enzyme recognition sequence of length (a) four and (b) six base pairs?arrow_forwardA) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involvedarrow_forwardDescribe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.arrow_forward
- Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: (see image) a) This plasmid is digested with the enzymes listed below. Indicate how many fragments will begenerated in each case, and give the sizes of the fragments.PstIXhoICombination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. c) This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.arrow_forwardMany restriction endonuclease recognition sequences are palindromes. What are palindromes? Are the recognition sequences for AatII and DraI palindromes? Some restriction endonucleases produce blunt-ended pieces of DNA, while other produce DNA fragments with sticky ends. What is the difference? What type of ends do AatII and DraI produce?arrow_forwardWhen the restriction endonuclease EcoRI is used to digest a 10 kb DNA fragment, it produces 4 kb and 6 kb-sized fragments. Digesting the 10 kb fragment with BamHI yields three fragments, each ranging in size from one to three and a half kilobytes. Four pieces of 0.5, 1, 3 and 5.5 kb are formed after using both enzymes. Create a restriction map for this 10 kb piece of DNA using the information you have collected. Make a note of where the two enzymes cut, as well as the distances between the enzymes.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)