MICROBIOLOGY - ACCESS FEE
MICROBIOLOGY - ACCESS FEE
5th Edition
ISBN: 9781260421163
Author: Cowan
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 9, Problem 4CTQ

Using the DNA sequence 3′ TAC CAG ATA CAC TCC CCT GCG ACT 5′ illustrate and explain the following mutations:

  1. a. a deletion
  2. b. an insertion
  3. c. a substitution
  4. d. a nonsense mutation
  5. e. a frameshift mutation

a.

Expert Solution
Check Mark
Summary Introduction

To explain: A deletion mutation by using DNA sequence.

Introduction:

Mutation in an organism is defined as a sudden alteration of “nucleotide sequences”. The mutations can be harmful, beneficial or neutral depending on the alteration in the genome and the effect exerted by the environment.

Explanation of Solution

Deletion mutation involves the removal of single base results in a frameshift mutation that changes the reading frame. Deletion mutation in given DNA sequence is:

3TACCAGATACACTCCCCTGCGACT53TACCAGATACACCCCCTGCGACT5.

b.

Expert Solution
Check Mark
Summary Introduction

To explain:

An insertion mutation by using DNA sequence 3TACCAGATACACTCCCCTGCGACT5.

Introduction:

The mutation causes an alteration in the nucleotide sequence of DNA. It is caused by natural as well as artificial factors. Mutagens are the agents that cause mutation in DNA. Mutation is a permanent change in the DNA sequence.

Explanation of Solution

The insertion mutation involves the addition of one or more nucleotide sequences in a gene that alters the sequence and results in changes the protein function. An insertion mutation in a given DNA sequence 3TACCAGATAACGTCCCCTGCGACT5

c.

Expert Solution
Check Mark
Summary Introduction

To explain:

A substitution mutation by using the given DNA sequence 3TACCAGATACACTCCCCTGCGACT5.

Introduction:

Mutation is defined as a change in the sequence of genetic material either due to the mistake in replication or due to the changes in the environment. DNA enzymes have a property of proofreading which prevents any mistake in a nucleotide sequence. But sometimes some mistakes during DNA replication are undetectable. These alterations in the nucleotide sequences are known as mutation.

Explanation of Solution

It involves the replacement of one base pair of DNA with another. Such type of mutation is silent as the mutated gene encodes for the same protein as the original gene. It is also called missense mutation. Due to substitution, the shape of amino acids is changed and its function also changes. For example sickle cell anemia. A substitution mutation in a given DNA sequence 3TACCAGATAGACTCCCCTGCGACT5.

d.

Expert Solution
Check Mark
Summary Introduction

To explain:

A non-sense mutation in a given DNA sequence 3TACCAGATACACTCCCCTGCGACT5.

Introduction:

Mutation is a sudden unpredictable change in the DNA sequence. It causes an alteration in the sequence of DNA. It is caused by natural factors or by exposure to certain artificial mutagens.

Explanation of Solution

The nonsense mutation occurs when base triplet that codes for a specific amino acid changes into stop codon and terminates the process of translation. Non-sense mutation in a given DNA sequence is 3TACCAGATACACTCCCCTGCGACT55AUGGUCUAAGUGAGGGGACGGUGA3.

e.

Expert Solution
Check Mark
Summary Introduction

To explain:

A frameshift mutation in a given DNA sequence 3TACCAGATACACTCCCCTGCGACT5.

Introduction:

Mutation is defined as the change in the nucleotide sequence of the gene which is results in a change in the coding of a different protein. Each codon codes for specific amino acid. It occurs due to physical and chemical mutagens.

Explanation of Solution

Insertion and deletion is a type of gene mutation which involves either addition or removal of one or more nucleotides bases from a sequence of DNA. Insertion and deletion mutation together lead to cause frameshift mutation. Insertion mutation occurs when nucleotides bases are inserted into the sequence of DNA whereas deletion mutation occurs when one or more nucleotide bases are deleted from DNA sequence. A frameshift mutation in DNA sequence 3TACCAGATACACCCCCTGCGACT5

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense
The change of a UAC codon (Tyr) to a UAU codon (Tyr) is an example of a:     A. missense mutation   B. silent mutation   C. frameshift mutation   D. nonsense mutation
The original DNA base sequence is  5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’.  What can you conclude about the mutation?   A. It is a frameshift mutation.   B. It is a silent mutation.    C.  It is a deleterious mutation.   D. It may result in a single amino acid change in the protein being coded for by this base sequence.

Chapter 9 Solutions

MICROBIOLOGY - ACCESS FEE

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY