Transposon%2520Mutagenesis%2520Session%25202%2C%2520In-Lab%2520Group%2520Assignment

typed answer and atremt all questions please

Please answer the rest

Question:- a.Explain the production of chymosin in a prokaryotic vector and the problems encountered in its production. b. What is chymosin used for and why the need for cloning the gene?

solve all 3 questions and typed answer please

Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kb

please answer and explain thoroughly!!!

Question in photo

drop down choices:  - functional  - non functional  - no transcription

I'm asking provide handwritten solution with right answer. Provide right answer

Please help me with this question within an hour???? with a proper explaination ASAP

Restriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…

Need help with question one

Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:

Thx!

Question:- How many different types of alterations in chromosomal numbers are there? -How can I use the F plasmid to introduce the transfer of the URA+ gene from a wild type strain into the ura- mutant strain you isolated in Q5.   -After obtaining the ura- mutant, I want to transform this ura- mutant back to wild type with a DNA sample prepared from the wild type cell. How can I achieve this transformation experimentally?

Biol370 - Assignment #2 – Spring 2020: Replication - Transcription - Translation Due 3/10/2020 (Before the beginning of the class) Name ID Instruction: 1. Print this document (US-letter only) Fill the table below with the appropriate color (see coloring rule) 3. Complete and annotate the drawing in attachment (see page #2). Make sure all the listed terms are present in your final drawing! (graded using 5 randomly selected terms 2. This type of drawing makes only sense for Eukaryotes/Prokaryotes (circle one) because: or The annotation must follow the coloring rule : DNA in BLACK. RNA in RED. Proteins and AAs in GREEN. Complex structures with some DNA and/or RNA and/or Proteins in BLUE. Color Color Color DNA DNA pol III Stop codon RNA RNA polymerase 5'-UTR Peptide Helicase 3'-UTR Leading strand Topoisomerase CDS Lagging strand Ligase RBS Coding strand Primer Ribosome SSU Template strand -10/-35 Box Ribosome LSU 5'/3' ends (all) Transcription start AA-TRNA N-/C- terminal ends…

Need help

Can someone tell me why the answer is that the spill contained transition inducing mutagens?

typed answer and atremt all questions please

Send me handwritten solution please

Question in photo

MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine     The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.

Answer the auestions below. Thank you.

Can you help with q 1 please

Please help me with this question ASAP within an hour

Need help, please.

I would like you to solve question 12.

Please explain for problem 1

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…

Primer Designing:

Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3D

Please help with 1a and 1b 1a.) what are the enzymatic activities of DNA pol I and DNA pol III ? 1b.) And what they're used for

Question 23 Match the following events in the recombinant DNA and cloning process Prompts gene of interest and the DNA vector are separately cleaved to generate ends that can join DNA is introduced to host cells vector DNA and the gene of interest are joined together only the clones with the recombinant DNA are used for downstream applications Submitted Answers Choose a match transformation marker-assisted selection directional cloning ligation by a ligase action restriction enzyme cleavage

I have complete the table that required. Indicate which mutations were success why some were not from the size about. indicate at what stage any of the mutagenesis failed.

Not sure if my answer is correct.