Assignment_2_ANS

Horizontal sequence :RIVL Vertical sequence:FMK   Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below.  NW algorithm.    1. Complete the scoring matrix.    Scoring matrix with PAM250 scores:   R I V L F         M         K           2. Set up, initialize and complete the NW matrix.  3. Retrace, align and score alignment(s).             Use the arrows and circles for the matrix and path(s).                                                                                                                                                                                                                                                                                                                                 R I V L             F           M           K           Align and score all optimal alignments here.  PLZ  the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment  Here the following…

please answer for all three questions  asap  all three questions are related

Please all question solve

STRs normally consist of repeating sequences of:   Question 46 options:   13-17 bases.   18-2 bases.   3-7 bases.   8-12 bases.

Instructions: Read 13-2 Manipulating DNA pages 322-323. As you read each section, examine the figures and captions (explanations). Identify any questions you may have. 1) Develop an analogy for the processes researchers use to make changes to DNA. In yo analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well the protocol for setting up and running a gel. You can add diagrams to the flowchart an add detailed notes if you like. English (inited Sate) O Focs ere to search 4 CO RU G\ L B. 2N A\ Alt Ciri

Please answer ASAP RNA sequencing (RNA-Seq) of one sample in one run of a massively parallel sequencing platform is quite expensive. However, a way to circumvent this cost issue is to pool and sequence more than one sample. How would you be able to distinguish and identify the reads from different samples?

Horizontal sequence :VIRL Vertical sequence:MKF   Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below.  NW algorithm.    1. Complete the scoring matrix.    Scoring matrix with PAM250 scores:   V I R L M         K         F           2. Set up, initialize and complete the NW matrix.  3. Retrace, align and score alignment(s).             Use the arrows and circles for the matrix and path(s).                                                                                                                                                                                                                                                                                                                                 V I R L             M           K           F           Align and score all optimal alignments here.  PLZ  the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment

Need help in 1 & 2 And if possible Analysis 1,2,&3

Question:- When completing genome sequences, contiguous sequences, or contigs are important intermediates. Which of the following is true about contigs? Group of answer choices   The smaller the contig, the better it is for a complete genome assembly.   A contig represents the sequence production from a single sequencing reaction.   A contig is the name for a fragment of DNA made from a larger genomic DNA or chromosome, prior to its sequencing.   A contig represents a DNA sequence assembled from smaller sequencing reads, and has no gaps.

Experiment: Bradford protein assaygive the answers (4-5 lines) of review questions in the end. the answer should be logical and understandable and without plagiarism. avoid copy-pasting. PLEASE GIVE THE ANSWER OF 3rd AND 4th QUESTION. ITS COMPULSORY.Background information:The Bradford assay is very fast and uses about the same amount of protein as the Lowry assay. It is fairly accurate and samples that are out of range can be retested within minutes. The Bradford is recommended for general use, especially for determining protein content of cell fractions and assessing protein concentrations for gel electrophoresis. The method described below is for a 100 µl sample volume using 5 ml color reagent. It is sensitive to about 5 to 200 micrograms protein, depending on the dye quality. In assays using 5 ml color reagent prepared in lab, the sensitive range is closer to 5 to 100 µg protein. Scale down the volume for the "micro assay procedure," which uses 1 ml cuvettes. Protocols, including…

2: Align DNA sequences using dot matrix Horizontal sequence: AGGCTCCC; vertical sequence: GCGCTCCG. Complete the dot matrix. Trace the features. Write the brief description of each feature below the matrix. For the dots, copy/paste this dot: • For noise reduction, use window size 2 x 2, mismatch limit 0, dot position 1, 1. Dot matrix after noise reduction: 3. Use the same sequences. For noise reduction, use window size 3 x 3, mismatch limit 1, dot position 3, 3. Dot matrix after noise reduction:

Question:- compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a text format and also in drawinv format. for drawing use same sample for both techniques

Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG

please asap

Primer Designing:

#4

Question : Comment Figure 3

solve only 2 and typed answer please

Choose [ Choose] BLAST systems biology proteomics roadmap epigenomics project ENCODE gene annotation proteome

Please don't provide handwriting solution

solve all 3 questions and typed answer please

Question:- When large genomes are sequenced, which of the following is true? Group of answer choices   The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced.   The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome.   Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used.   The assembled sequences must have all gaps closed if the genome is to be useful for the research community.

Give only typing answer with explanation and conclusion Information: 1_Green Fluorescent Protein 2_nucleotide sequence, Amino acid sequence, and primers are obtained. 3_PCR protocol already described 4_bp has been calculations and estimated agarose gel image already designed. Questions: How do you analyze whether your target protein is expressed by E. coli cells. Explain your analysis method in detail and give information about the results you expect (in detail please)

30

please give thorough explanation for why answer is D with all steps

18

Question: Some scientists have concluded that this method of gene therapy will be a more effective long-term treatment for SCD than HSCT. Use all the information provided to evaluate this conclusion. I dont know how to answer this question pls help:(

#3 question help

QUESTION: Transcribe the gene. Write out the correct sequence of m RNA bases. Notice that this is the same gene as in B above. Recall that in RNA, thymine (T) does not exist and uracil (U) takes its place. 3' ССА TAG CÁC CTT GTC ACA ACG TGT TCG TAG ACA 1 3. 4. 6. 7. 8. 9- 10 11 AGG AAC АТА ATA GTT AAC CTT TTG ATA ACA ТТА ACT 12 13 14 15 16 17 18 19 20 | 21 in

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.

Pls can anyone explain how to solve this exercise and it means? thank you sm!