1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning. b) Find the peptide sequence that this DNA chain will synthesize and show the energy balance required for its synthesis and indicate its total load at physiological pH. c) How do you prove that this peptide sequence is as above? Explain.

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced…

A: Introduction  Genes contains specific nucleotide sequences which can be transcribed into the mRNA by…

Q: Match Column A  (Description) with Column B (protein/enzyme)

A: One new strand (the leading strand) is created as a continuous segment during DNA replication. The…

Q: Identify the sites of lagging strand synthesis. Select all that are true. 5 O a. A O b. C O c. B O…

A: Introduction:- The process of replicating a double-stranded DNA molecule into two identical DNA…

Q: DNA replication always proceeds in only one direction because the ________ of the incoming…

A: DNA replication is an important part of the cell cycle and it takes place in the S-phase of the cell…

Q: Distinguish between (a) unidirectional and bidirectional synthesis, and (b) continuous and…

A: Answer- DNA replication or synthesis of DNA is the formation of DNA from the parental strand in the…

Q: Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template…

A: DNA is deoxyribonucleic acid. The nucleic acids are the building blocks of DNA molecules.  DNA is a…

Q: In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in…

A: The DNA double helix model is generally one of the best discoveries of the 20th century. DNA is…

Q: Describe the basic features of the DNA double helix

A: BASIC INFORMATION CELL It is considered as the basic unit of life Every organism is made up of cell…

Q: 3. Imagine that the double-stranded DNA molecule shown was broken at the sites indicated by spaces…

A: In given sequence , broken Strands of double stranded DNA was indicated by spaces. Hence , broken…

Q: Draw the reaction between a growing strand of RNA and the next nucleotide added. Clearly show the…

A: Transcription is the process of making a copy of an RNA genetic sequence. This copy, called the…

Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…

A:

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…

A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…

Q: 1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA…

A: DNA replication is the process of production of identical copies of DNA molecules with the help of…

Q: how are the polypeptide chains of protiens that are specified by dna assembled

A: Polypeptide chains undergo four levels of folding :  Primary structure: defined by their amino acid…

Q: List at least five properties that DNA polymerases and RNA polymerases have in common. List at least…

A: The polymerase is an enzyme that synthesizes the long chains of nucleic acids or polymers. The DNA…

Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…

A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: Describe in detail the semi Conservative replication of the DNA double helix structure

A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…

Q: 1. a) If one DNA segment  has the following base composition, 5'-CAGTTAGTCA-3', which of the…

A: I  Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G…

Q: Explain the effect(s) the following scenarios would have on DNA replication or translation. For each…

A: Replication describes how cells continue to divide after they have completed the process of cell…

Q: The template strand of a segment of double-helical DNA contains the sequence –…

A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…

Q: During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following…

A: Replication is a biochemical process by which the DNA is synthesized on itself. It is mode by which…

Q: A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following…

A: Multiple copies of DNA copies can be achieved with the polymerase chain reaction in large amounts of…

Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…

A: DNA sequencing  Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.

Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…

A: DNA is Nucleic acid that consists of two strands that run in opposite directions. One of the stand…

Q: Discuss the differences between the Z-Form, A-form and B-form Dna

A: DNA (Deoxyribonucleic acid) is a molecule which is present in the nucleus of the cell. It contains…

Q: Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand…

A: Coding strand - The strand of DNA whose base pairs sequence is identical to RNA transcript base pair…

Q: A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter…

A: Answer: Introduction: In living organisms, primers are short strands of RNA or DNA commonly 18-22…

Q: (i) (.. From the diagram to the right of the trp repressor in its approximate binding relationship…

A: Tryptophan (trp) repressor: It's a transcription factor that regulates amino acid metabolism. The…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…

A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Explain briefly how the double-helical structure of DNA suggests a mechanism for DNA replication?

A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced…

A: The transcription process enables an enzyme known as RNA polymerase to bind to the DNA and break…

Q: (a) What will be the problem during DNA replication if the enzyme primase becomes non-functional?…

A: DNA replication a process by which DNA makes copies of itself and this process requires lots of…

Q: On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: 1. Why is the specific base pairing is essential to the processes of transcription and translation?…

A: Introduction Translation:- It is the process in which a cell makes proteins using the genetic…

Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…

A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…

Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’…

A:

Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…

A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…

Q: Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in…

A: Inversions are half-circle rotations of a region of a single chromosome. It is important to remember…

Q: 1. A DNA base sequence transcribed into messenger RNA in the following sequence:…

A: Introduction :- Transcription is the process through which synthesis of mRNA molecules takes place ,…

Q: Using the figure below identify: What is a function of introns and exons? What is a role of mobile…

A: DNA is packed up compactly in the nucleus of a cell in close association with histone proteins…

Q: Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA…

A: Mutations can be the change in the sequence of DNA and RNA, and mutations can be caused by a…

Q: 1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP…

A: AP endonuclease : It is an enzyme which is involved in the DNA base excision pathway The main…

Q: , Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…

A: Note- According to the guidelines, we are supposed to solve first three subparts (a, b and c) of a…

Q: Describe the three important functions of DnaA protein.

A: The protein that helps in the activation of DNA replication initiation in bacteria is DnaA. It…

Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.