16S sequence information will be composed of: As and Us and Cs and Gs that make up the mRNA sequence As and Ts and Cs and Gs that make up the DNA sequence amino acids that build the ribosome amino acid codons that make up the mRNA small enzymes that build the ribosome

16S sequence information will be composed of: As and Us and Cs and Gs that make up the mRNA sequence As and Ts and Cs and Gs that make up the DNA sequence amino acids that build the ribosome amino acid codons that make up the mRNA small enzymes that build the ribosome

Name: 16S sequence information will be composed of:As and Us and Cs and Gs
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 16S sequence information will be composed of:As and Us and Cs and Gs that makethe mRNA sequencednAs and Ts and Cs and Gs that make up the DNA sequenceamino acids that build the ribosomeamino acid codons that make up the mRNAsmall enzymes that build

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 18RQ: A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell...

See similar textbooks

Similar questions

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Which pre-mRNA processing step is important for initiating translation? poly-A tail RNA editing splicing 7-methylguanosine cap
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the above
The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.