2. Of the hundreds of confirmed tRNA genes in the human genome, only one has the sequence 5' ATT 3' at the site that encodes for the anti-codon. How may the rarity of that codon influence the speed and accuracy of translation?
Q: 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the…
A: DNA acts as the genetic material in most of the organisms present on earth. DNA is first transcribed…
Q: 3. List the sequences for the "stop" codons.
A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?
A: Ribosomal and transfer RNAs are processed in both prokaryotes and eukaryotes. The processing of…
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…
Q: What codons are found in the mRNA for the two mutated DNA
A: 1. The cell reads the sequence of the gene in groups of three bases. There are 64 different codons:…
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…
Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…
Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…
A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…
A: DNA is the genetic material as it contains all the information required to make all the proteins and…
Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…
A: As per the guidelines we are supposed to answer only the first question in case of multiple question…
Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…
A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: 2. What would happen if a mutation in DNA changed codon 6 in the MRNA to GUA? (This one nucleotide…
A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…
Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…
A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…
Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…
A: "Transcription" and "Translation" are two important processes that take place inside the cell for…
Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…
A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…
Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: 8. Which RNA molecule is NOT involved in the processes of transcription and translation? A.…
A: RNA or Ribonucleic acid is a type of nucleic acid. Transcription is the process of synthesis of…
Q: What codons ar e found in the mRNA for the two mutated DNA?
A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…
Q: 7. Look at 6a and 6b. Compare the RNA sequences and the polypeptide sequences they code for. What…
A: A base pair is two nucleotides that together constitute a DNA ladder." A DNA nucleotide is composed…
Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…
A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…
A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: If a different point mutation changed the DNA code from ACG to ACT, would that cause a problem with…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…
A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…
Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e.…
A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…
A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…
Q: Compare the structure and functions of DNA nad RNA.
A: Nucleic acids DNA RNA DNA : Deoxyribonucleic acid : It is long chain polymer of two…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: 2. Which one of the following statements is TRUE of bacterial transcription? A. It produces pre-mRNA…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to…
A: The coding sequences of Eukaryotic DNA is called exon and the non coding sequence of Eukaryotic DNA…
Q: 2. How is RNA termination different in prokaryotes vs eukaryotes? Include an explanation of cis vs.…
A: The process of creating a copy of RNA (ribonucleic acid) of a gene sequence can be referred to as…
Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…
A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…
Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…
A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…
Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…
A: Need to fill the blanks related to transcription process.
Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…
A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…
Q: 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is…
A: Genetic code is a set of three nucleotides where one triplet is called as one codon.
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…
A: The DNA expression involves the protein synthesis which involves a series of events primarily the…
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
Q: If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Step by step
Solved in 3 steps
- Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycineAn unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
- 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U C A G UUU UUC- UUA UUG- H₂N+ H H₂N-C- Phe (F) CUU- CCU CUC CCC CUA CCA CUG- CCG AUU ACU AUC Ile (1) ACC AUA ACA AUG Met (M) start ACG- GUU GCU GUC GCC GUA GCA GUG- GCG Nonpolar side chains; hydrophobic Leu (L) U Side chain (R group) OH CH₂ Leu (L) H₂N-C Val (V) HO Glycine (Gly or G) CH3 S CH₂ CH₂ Polar side chains; hydrophilic H O Methionine (Met or M) 0 H₂N-C Second base in codon UCU UCC UCA UCG OH CH, CH HO Aspartic acid (Asp or D) HO Alanine (Ala or A) 0 H O Serine (Ser or S) HO Threonine (Thr or T) Electrically charged side chains; hydrophilic CH3 H₂N-C-C-0- Acidic (negatively charged) CH₂ H₂N+ C CH₂ CH₂ H₂N-C-C-0- H₂N-C- C CH₂ Ser (S) Pro (P) Thr (T) H O…16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…2. Given a DNA template molecule of 5' - ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence and then the polypeptide sequence, starting at the first start codon. mRNA: 5'- CCAU AUG UUA ACU AGU AGG UAG GAG CCA U - 3' Polypeptide: (N) Met-Leu - Thr - Ser - Arg (C)
- 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the following nucleotide sequence. Give the primary structure of the polypeptide (use 3-letter amino acid codes), beginning with the most common translation initiation codon, that will be specified by this portion of the gene. Be sure to label the ends of the polypeptide. 3'-TTTTACGGGAATTAGAGTCGCAGGATG-5'1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…
- 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?
