9. You sequence the genomes of four different organisms and compare their sequences over a short regionas shown below.5′ AGGTATATAATTTGCG 3′5′ CAATATAAAACCCTAC 3′5′ GCGTATAAAAGAGCTA 3′5′ TTATATATAAAGAAGT 3′a. Determine the consensus sequence common to thefour regions above.

9. You sequence the genomes of four different organisms and compare their sequences over a short regionas shown below.5′ AGGTATATAATTTGCG 3′5′ CAATATAAAACCCTAC 3′5′ GCGTATAAAAGAGCTA 3′5′ TTATATATAAAGAAGT 3′a. Determine the consensus sequence common to thefour regions above.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 9RQ: Three different bacteria species have the following consensus sequences upstream of a conserved...

See similar textbooks

Related questions

Q: Next generation sequencing using Illumina platforms identifies individual bases in a DNA fragment…

A: The following steps are involved in next generation sequencing: 1) First the DNA sequencing…

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap help in translation and prevent degradation of m- RNA and poly A tail help on initiation of…

Q: 3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can…

A: The complete genome of E.coli is 5.44 million base pairs. The genome is replicated entirely in one…

Q: 1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…

A: DNA replication is a mechanism that involves breaking and building bonds. Replication occurs in 3…

Q: 5. Describe the process of DNA sequence of interest detection, using these terms appropriately,…

A: Introduction: DNA sequencing method is used to determine the exact base sequence in a DNA. Three…

Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…

A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…

Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…

Q: You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its…

A: As organisms evolve, their DNA and protein sequences change. According to the molecular clock…

Q: 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four…

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic sequence in the…

Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'

A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…

Q: 5) The restriction enzyme EcoRI recognizes the DNA sequence GAATTC and makes a staggered cut as…

A: Restriction enzymes have specific recognition site on DNA at which they binds and cut the DNA into…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…

Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…

A: Defination of the gene :-

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…

Q: You are assembling the genome sequence of a newly discovered bacterium by aligning a set of BAC…

A: Assembly involves taking a large number of DNA reads, looking for areas in which they overlap with…

Q: B. Genome Mining 1. Using the sequences from the previous activity, identify the organisms to which…

A: DNA sequencing - DNA sequencing refers to the general laboratory technique for determining the exact…

Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…

Q: )A scientist compares the sequence of a disease gene and a healthy gene and finds that these two…

A: The gene is the unit of heredity that is carried out from the parents to the offspring. This…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…

Q: 2. The restriction enzymes Xhol and Sall cut their specific sequences as shown below: Xhol 5'-c…

A: Restriction enzyme are also referred as restriction endonuclease. They are considered as a protein…

Q: According to Picotti (2013), Rudi Aebersold (a leader in mass spectrometry-based proteomics) hopes…

A: The application of scientific and technical principles to the processing of the material by…

Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…

A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…

Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…

A: DNA sequencing Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.

Q: Corn_AA DVVINHRCA---DYKDGRGIYCVFEGG---TPDSRLDWGPDMICSDDTQYSN--GRG 16 :: Figure: Sequence alignment…

A: Sequence alignment is defined as the arrangement of sequences of DNA, RNA, proteins to identify…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: 3. In your own words, identify one similarity and one difference between 16S sequencing and…

A: Sequencing is a advance technique that determine the order of nucleotide of the DNA fragments.

Q: What are the different elements you would need if you wanted to perform CRISPR to edit a gene?

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…

A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG

A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: 3. After analyzing a DNA sequence for gene properties, the following sequences were reported at the…

A: Introduction : Genetic Codon: The Genetic Code Is A System Of Rules That Live Cells Employ To…

Q: 41. The template strand of a gene has the sequence 3'-TCCCATGAG-5', Which of the following would be…

A: Amino acids are the structural unit of proteins. there are majorly of 20 amino acids which are…

Q: 8.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled…

A: Primer - A primer, as related to genomics, is a short single-stranded DNA fragment that anneals with…

Q: 9. You sequence the genomes of four different organisms and compare their sequences over a short…

A: The consensus sequence is a sequence of amino acids in protein or bases in DNA or RNA. It is…

Q: 1. What is the difference between an iterated blast (psi-blast) search and a simple blast search? 2.…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: For 4 spots, 8 legs and straight antennae the peptide would be Met-Gly-Val-His-Ile-Tyr-ala-Ile-Ile…

Q: SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN Find the template? Use swiss model to build the…

A: The bioinformatic is major computational biology used to find the nucleotide, protein sequence of…

Q: (D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA sequences consisting…

A: mRNA: Messenger RNA It is a type of RNA that plays a very important role in protein synthesis…

Q: List the DNA strand sequence complementary to the template strand.…

A: DNA contains Adenine thymine, cytosine, and Guanine. Whereas in RNA the Thymine is replaced by…

Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…

A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…

Q: 1. Which of the following are generated due to the twisting of dsDNA? a. Hydrophobic bonds b. Van…

A: DNA acts as genetic material in most organisms. DNA is a double-helical structure in which two…

Q: 3. The presented sequences are coming from one ancestral sequence. Through RE, the ancestral…

A: DNA sequencing is a laboratory technique used to determine the exact sequence of bases (A, C, G, and…

Q: 2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded…

A: Hydrogen bonds are one most most frequently seen chemical bonds in biomolecules , whether it be in…

Q: 8. You have a piece of DNA with the sequence shown below.…

A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…

Q: 3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase…

A: 3. the process of transcribing complementary DNA from RNA is called as reverse transcription. this…

Q: 7. Which of the following base sequences are probably not recognition sites for cleavage by…

A: Restriction endonucleases are the molecular cutters which is used to split DNA in the center but…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

9. You sequence the genomes of four different organisms and compare their sequences over a short region
as shown below.
5′ AGGTATATAATTTGCG 3′
5′ CAATATAAAACCCTAC 3′
5′ GCGTATAAAAGAGCTA 3′
5′ TTATATATAAAGAAGT 3′
a. Determine the consensus sequence common to the
four regions above.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Three different bacteria species have the following consensus sequences upstream of a conserved gene. Species A Species B Species C -10 TAATAAT TTTAAT TATATT -35 TTGACA TTGGCC TTGAAA Table 15.2 Order the bacteria from most to least efficient initiation of gene transcription. A > B > C B > C > A C > B > A A > C > B
1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
5'.....GATTGCAT.....3' Which molecule below will hybridize to your sequence of interest? Why? A) 5' -GATTGCAT-3' B) 5' -TACGTTAG -3' C) 5' -CTAACGTA -3' D) 5' -ATGCAATC -3'
1) What DNA base sequence is complementary to the following DNA sequence?TAGCGTGCATGGTGCTTAAC2) What RNA base sequence is complementary to the following RNA sequence?UAAUAGCUUGCUGAU
3. Come up with a short (<15 bp) genome sequence and a k value that would result in multiple possible assemblies using the DBG algorithm. Show the original sequence, graph, and all valid/possible sequence reconstructions. Explain why your sequence has this property. asap please.
1. What is the difference between an iterated blast (psi-blast) search and a simple blastsearch?2. Arslan sequenced a gene in lab how he will know about the gene either it is noveldiscovery or gene is already present in the database?3. Ruwaifa want to compares a nucleotide query sequence what option he will opt inBLAST and why?4. Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of DNA that carries the genetic information needed to make a protein c. the structure into which DNA is packaged d. a segment of RNA that carries the genetic information needed to make a protein 2. In the double-stranded DNA, the base pairs are: a. G-A and T-U b. G-C and A-U c. A-T and G-C d. A-U and G-C