a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 .3'тTGCATCСGAAАCGTACGATCGATCEGCCGACTТАТТАСGATCGGACTAФTGCGTCсТAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'.. (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). 2.

Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…

A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: 8. The following diagram represents the Christmas-tree-like structures during transcript On the…

A: E. Eliminators are viewed downstream of the quality as deciphered, and ordinarily happen…

Q: 2. The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…

A:

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…

Q: A certain template DNA strand has the following nucleotide sequence:…

A: DNA is doubled stranded and has two strands - a template and a coding strand. Here, given a template…

Q: Explain what the term position effect means.

A: Position effect in genetics have different variations which result into new genotype and phenotypic…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule…

A: Thank you for the question  Answer The Genes code for proteins. These proteins are the workhorse of…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: A small section of bacterial DNA template  (anti-sense) strand has the following nucleotide…

A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur…

Q: What is the difference between true, intragenic and a second-site reversion?   Does the Ames test…

A: Reverse mutation or reversion is a second mutation which corrects the initial mutation. This…

Q: A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding…

A: Since we know in RNA Thymine is replaced by Uracil. So Adenine is binded to Uracil. This forms the…

Q: A. Refer to the figure below and explain DNA packaging and Describe 1 structural…

A: DNA is the genetic material of organisms which inherits from generation to generation from parents…

Q: Below you will find the normal p53 gene found on chromosome 17 and a mutated version of the gene.…

A: To solve such questions, we should know the corresponding complementarity between the bases and that…

Q: Gene 1 Gene 2 Gene 3 ori 3' DNA E -5' transcription 5' 3' 5' 3' 3' 5' MRNA 1 MRNA 2 mRNA 3…

A: INTRODUCTION: In bacterial chromosome, related genes are found in the cluster on the chromosome,…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Which of the following plays a major part in determining whether or not RNA polymerase will…

A: RNA polymerase is an enzyme that helps to convert a DNA sequence into an RNA sequence in the…

Q: Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G…

A:

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: Please choose the correct answer. The transcriptional complement of the DNA strand with the code 3’…

A: Transcription is the process in which DNA is copied to RNA. Translation is the process of making…

Q: 1.This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the…

A: This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Given:

Q: Part of the protein-coding region in a gene has the base sequence 3-…

A: Adenine (A), cytosine (C), guanine (G), and thymine (T) are the four nucleotides that makeup DNA…

Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…

A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…

A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA  mRNA - Complementary to…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: Use the (non-template) DNA strand below to determine which is the promoter/sigma binding region:…

A: Introduction: A promoter is a DNA sequence to which proteins bind to start transcription of a single…

Q: Predict the resulting DNA strand in the presence of a mutagen that causes the ADDITION of one…

A: During protein synthesis pathway, the N-terminus is the first component of the protein to leave the…

Q: identify the type of DNA binding motif is shown and the characteristics.

A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…

Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…

A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub- parts for…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: a) Complete the table below. Assume that reading is from left to right and that the columns…

A: In molecular biology central dogma is the mechanism which takes place from the DNA(hereditary unit…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: You see partial sequence of a gene as follows (non template strand shown)…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…

A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: I. The DNA template, 3'–CGTTACCCGAGCOCGTACGATTAGG–5', was exposed to a mutagen, resulting in the…

A: Hi, Since you have posted a question with multiple sub-parts, we are answering only first one for…

Q: The coding sequences of Gene Fand Gene G are shown by the double-stranded DNA below: Gene F 5'…

A: The process of making a copy of an RNA sequence from a gene sequence is called transcription. The…

Q: summarize these results using concise language in a neat table;   Control : 5’…

A: There are different types of mutations based on the changes in DNA sequences. It includes missense,…

Q: 8. You have a piece of DNA with the sequence shown below.…

A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…

Q: Briefly state the function of each of the lettered sites on the outlined gene below. +1 ТАТА Coding…

A: DNA ( Deoxyribonucleic acid ) is two stranded helical / ladder like structure which act as genetic…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: RNA transcription is a process where double-stranded DNA is transcribed into mRNA. This mRNA is…

Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…

A:

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.