I. The DNA template, 3'–CGTTACCCGAGCOCGTACGATTAGG–5', was exposed to a mutagen, resulting in the following three templates. 2. A. 3'–CGTTACCCGAGCCGTAACGATTAGG-5' nserti on leuding to frame shift B. 3-CGTTACCCGATCCGTACGATTAGG–5' Point - Transversin C. 3'-CGTTACCCGAGCCGTTCGATTAGG–5' Transition I. Transcribe and translate each template and write down the primary sequence of the resulting polypeptide/protein. Describe how each of the mutations will affect the final protein product from the corresponding template. N met -gla - Ser- Ala -cys -Stup-d Predict whether gene expression (from initiation of transcription to final protein product) would be faster in a prokaryotic or eukaryotic cell. Explain your answer.

I. The DNA template, 3'–CGTTACCCGAGCOCGTACGATTAGG–5', was exposed to a mutagen, resulting in the following three templates. 2. A. 3'–CGTTACCCGAGCCGTAACGATTAGG-5' nserti on leuding to frame shift B. 3-CGTTACCCGATCCGTACGATTAGG–5' Point - Transversin C. 3'-CGTTACCCGAGCCGTTCGATTAGG–5' Transition I. Transcribe and translate each template and write down the primary sequence of the resulting polypeptide/protein. Describe how each of the mutations will affect the final protein product from the corresponding template. N met -gla - Ser- Ala -cys -Stup-d Predict whether gene expression (from initiation of transcription to final protein product) would be faster in a prokaryotic or eukaryotic cell. Explain your answer.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Refer to the succeeding diagram of two DNA samples (A, B) with the specific restriction enzyme(RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNAsample A and introduced an additional restriction site. 1. Design two (2) DNA probes to be used in RFLP analysis involving these two DNA samples.Draw/illustrate the region(s) in the DNA molecule which you will use as reference(homologous) sequences in the design of the probes, THAT -a. Will reveal RFLP polymorphism between the DNA samples after probedetection/visualization; andb. Will not reveal RFLP polymorphism between the DNA samples
In generating mutations in a bacterial gene involved in antibiotic resistance, a number of point mutations are isolated that render the bacteria sensitive to the antibiotic. You would like to sequence the gene in order to characterize the mutations, but unfortunately, your lab partner just finished the last of the lab's supply of DNA polymerase. The only things at your disposal are materials for performing a western blot, allowing you to visualize the protein encoded by the gene. How would you identify which mutations are likely to be the result of a missense mutation, which are likely to be the result of a nonsense mutation, and which are likely to be the result of a frameshift mutation?
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)
1)Explain why there is a part of the Lacz gene in pUC18119 and also how the natural biochemical process wherein it normally functions is used during cloning by molecular biology. 2)Write down the basepairs of double-stranded ONA that is generated at the joint between a plasmid that is digested with Xhol and a DNA fragment that is digested with Sall and joined by DNA-ligase. Indicate the 5'- and 3'- termini of each strand.