Assume a cell present in your body has performed a mismatch error during the process of DNA replication. This error has resulted in the generation of a new allele for one of your genes. For this new allele to be inherited by your offspring, which of the following conditions must be true? A The new allele produced must be recessive. В The error must be caused by a chemical mutagen that exists in hostile environments. C The error must occur in the germ line cells responsible for the production of gametes. The error must occur in the germ line cells responsible for the production of somatic cells.

Assume a cell present in your body has performed a mismatch error during the process of DNA replication. This error has resulted in the generation of a new allele for one of your genes. For this new allele to be inherited by your offspring, which of the following conditions must be true? A The new allele produced must be recessive. В The error must be caused by a chemical mutagen that exists in hostile environments. C The error must occur in the germ line cells responsible for the production of gametes. The error must occur in the germ line cells responsible for the production of somatic cells.

Name: Assume a cell present in your body has performed a mismatch error dur
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Assume a cell present in your body has performed a mismatch error during the process of DNA replication. This error has resulted in the generation of a new allele for one of your genes. For this newallele to be inherited by your offspring, which of

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter13: Genes, Chromosomes, And Human Genetics

Section: Chapter Questions

Problem 3ITD

See similar textbooks

Similar questions

When the DNA of a human cell becomes damaged, the p53 geneis activated. What is the general function of the p53 protein?Is it an enzyme, transcription factor, cell-cycle protein, orsomething else? Describe three ways in which the synthesisof the p53 protein affects cellular function. Why is it beneficialfor these three things to happen when a cell’s DNA hasbeen damaged?
Why would a mutation in a somatic cell of a multicellular organism not necessarily result in a detectable phenotype?
Which, if any, of the following statements is false? a) Most of the inherited changes in our DNA arise because of exposure to extracellular mutagens, including radiation sources and chemical mutagens. b) Most of the inherited changes in our DNA arise because of unavoidable endogenous errors in cellular mechanisms and harmful effects of certain natural molecules and atoms within our cells. c) Errors in DNA replication and DNA repair are a major source of mutations in our cells. d) Significant chemical damage is sustained by DNA because of its proximity to water molecules in our cells.
Are mutations that arise during mitosis or meiosis the same? Explain in 15 sentences.
According to the endosymbiosis theory, mitochondria and chloroplasts are derived from bacteria that took up residence withineukaryotic cells. At one time, prior to being taken up by eukaryoticcells, these bacteria were free-living organisms. However, we cannot take a mitochondrion or chloroplast out of a living eukaryoticcell and get it to survive and replicate on its own. Discuss why not.
Discuss why a genetic disease might have a particular age of onset.Would an infectious disease have an age of onset? Explain why orwhy not.
Categorize each of the following events as an example of genetic inheritance or epigeneticinheritance. a. For a line of liver cells growing in a laboratory, a gene encoding an immune cytokine isfound in compact chromatin.b. A chromosomal rearrangement in a blood stem cell leads to leukemia.c. Haploid bees are male, and diploid bees are female.d. Among genetically identical lab mice, those exposed to cigarette smoke have a higherrate of developing lung tumors
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
Mutations must occur in which cells of the parent to be inherited by their offspring?
In genetic transformation, what is meant by the wordcompetence?
Familial retinoblastoma, a rare autosomal dominant defect, arose in a large family that had no prior history of the disease. Consider the following pedigree (the darkly colored symbols represent affected individuals): a. Circle the individual(s) in which the mutation most likely occurred. b. Is the person who is the source of the mutation affected by retinoblastoma? Justify your answer. c. Assuming that the mutant allele is fully penetrant, what is the chance that an affected individual will have an affected child?
. If you were a genetic counselor and had a patient withMERRF who wanted to have a child, what kind of advice could you give about the chances the child wouldalso have the disease? Are there any tests you couldsuggest that could be performed prenatally to determine if a fetus would be affected by MERRF?