Q: Would you expect the Rf value for tryptophan to be closer to that of leucine or arginine? Why?
A:
Q: In an experiment that uses TLC, like the one performed in this course, which of the following…
A: Thin layer chromatography (TLC) is used to isolate and separate non-volatile mixtures based on their…
Q: The electrospray ionization mass spectrum of the tripeptide Ala-Met-Thr shows peaks of…
A: Given peptide is: Ala-Met-Thr
Q: Suggest a mechanism of enzyme catalysed reaction along with the diagram
A: A catalyst is defines as a substance which when present in a chemical reaction accelerates its…
Q: Using palmitoleic acid and neglecting stereochemistry, illustrate the reaction of palmitoletic acid…
A: Palmitoleic acid is also known as hexadec-9-enoic acid. It is present in all tissues but found in…
Q: Predict the reactions ofcarbohydrates in acidic and basicsolutions, and with oxidizingand reducing…
A:
Q: Search the standard of Bendroflumethiazide and its tablets USP. •What kind of method applied in the…
A: "Since there are multiple sub-parts in this question and it is not mentioned that which one has to…
Q: a) A certain lipid has the structure shown below (R1 and R2 are fatty acyl chains). Could a sample…
A: Lipid bilayer consists of two layer of lipid molecules. Each phospholipid molecule contain a…
Q: The UV-vis absorption spectrum of the peptide RYYFE collected in a 1 cm pathlength cuvette exhibits…
A: the optical path length and the molar concentration of the solution. i.e.…
Q: Identify the electrophilic centre that is attacked on the structure of parecoxib. For this question…
A:
Q: A new protein of an unknown structure ha graphy (gel filtration) reveals that the native absence of…
A: Given: weight of native protein - 100 kDa dithiotreitol - 50 kDa
Q: CI Assume the partition coefficient for this compound is too high. Propose a structural modification…
A: The partition coefficient is ratio of molar concentrations of chemical in a non aqueous phase and…
Q: Summarize and briefly explain the chemical interaction between EDC and NHS in Electrochemical…
A: As per the guideline, Since you have asked multiple questions, we have solved the first question for…
Q: In the spectrum below, what types of bonds do the significant adsorptions in the functional group…
A: Depending upon the bond strength and reduced mass of the functional groups, the stretching frequency…
Q: there you found that labels had fallen off from the bottles containing D-lyxose and D-xylose. How…
A: D-xylose and D-lyxose are two aldopentoses. These are epimeric to each other at carbon number 3.
Q: A. Distinguish the amine component from the coupling component in the given azo dye. B. Sketch the…
A:
Q: Show by a series of equations (with structures) the first stage of the Edman method applied to a…
A: Edman degradation given by Pehr Edman, it is a process of purifying protein by sequentially removing…
Q: intramolecular intermolecular 1. Propose an experiment involving a singly-labelled substrate that…
A: The objective of the question is to propose a labelling experiment to distinguish between…
Q: Which of the following can determine location of glysosidic linkages? A. Fractional analysis…
A: Fractional analysis using HPLC in tandem with MS HPLC stands for high performance liquid…
Q: What effect do you think an old Gram's Crystal violet preparation containing crystallized dye will…
A:
Q: write equation and draw a well labeled outline showing how the resolution of ibuprofen process…
A:
Q: Does the Enalapril molecule follow Lipinskis rules? why or why not? H
A: Lipinski's rules: It is the set of rules that have to be obeyed by the molecule in order to consider…
Q: Define heterolytic cleavage.
A:
Q: Calculate the index of hydrogen deficiency of this compound Q.) Urea, CH4N2O
A: The rings and multiple bonds reduces the hydrogen count by two and it is known as index of hydrogen…
Q: 9. For the following aspartate reaction in the presence of inhibitor, Km = 0.00065 M. Determine Vmax…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy. It…
Q: The encircled part of the TGA indicates loss of...
A: The variation of the mass of the substance with respect to the change in temperature values observed…
Q: Differentiate direct dyeing from ingrain dyeing. Considering the structure of cotton and Sudan-1,…
A: Dye is a chemical compound which gives colour. It is used for the coloration of the papers, fabric…
Q: On the basis of the tlc results, explain how you would you be able to argue that acetanilide you…
A: Interpretation- To explain that how on the basis of TLC results we will able to argue that…
Q: Show hoe the Cahn-Ingold-Prelog sequence rules are used to assign the configuration of the…
A: Cahn-Ingold-Prelog rules are used to assign configuration to a chiral carbon in a molecule. A chiral…
Q: Which separation technique is the most specific and offers the highest protein purification…
A: Chromatography is one the best technique for separation of molecules. It is based on the principle…
Q: Make an electron-flow-mechanism for this synthetic scheme. This involves predicting major and…
A: The carboxylic acid functional group is represented by R-COOH, where R can be an alkyl or aryl…
Q: Poopose mechanlom for following transpormation ?
A:
Q: There have been cases where wine has been mistakenly adulterated with ethylene glycol…
A: Chromatography is an analytical technique in which a sample mixture is separated into different…
Q: In the caffeine isolation, Explain why? a) calcium chloride, b) dichloromethane, c) toluene are…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: In the spectrum below, what types of bonds do the significant adsorptions in the functional group…
A:
Q: There are almost 500 naturally occurring variants of hemoglobin. Hemoglobin X is a hemoglobin…
A:
Q: What is the commercial use of ibuprofen? 2. What are the important criteria of a good resolving…
A: 1) Commercial use: It is used to relieve pain from various conditions like - headache,…
Q: Is it possible to resolve a racemic mixture of 1-phenylethylamine with (-)-malic acid?
A: Find answer next steps
Q: The Merrifield solid phase synthesis is commercially used for the production of peptides. Identify…
A: Unlike the translation machinery of lifeforms, Merrifield peptide synthesis starts from the…
Q: If you did not get a 100% pure sample of (+)-phenylsuccinic acid from Polarimetry experiment, how…
A: Using resolution process, phenyl succinic acid can be purified. The enantiomers are first treated…
Q: What is the changes in TZDs (specifically pioglitazone) structure that has direct impact in clinical…
A: The thiazolidinediones are TZDs or glitazones belong to a class of antidiabetic drugs and improve…
Q: 1) Compare between three steps for Kjeldahl method for determination of protein?I
A: INTRODUCTION: Kjeldahl method is defined as the method which is used for quantitative determination…
Q: How Ranitidine will be syntesized? give full reaction
A: Ranitidine : Ranitidine is a drug that is used orally and it belongs to class of drug called…
Q: You have a peptide with the sequence HEEDRKYYLCG. You may assume that the side-chain pKa values from…
A: At pH above the pKa value of a particular group of an amino acid, the group gets deprotonated. At pH…
Q: what the mechanism of action of EDTA in the study, advantages and results obtained.
A:
Step by step
Solved in 2 steps with 2 images
- What is the effect of temperature on chemisorption?3. Calculate the pKb for thefollowing:a. Novocain, Kb = 7 x10-6b. methyl red, Kb = 3 x 10-12One of the drawbacks of older methodology for nonprotein testing was that ________________, which modern methods have corrected for. Question 2 options: A) a protein-free filtrate needed to be made B) it was difficult to separate BUN from creatinine C) ammonia was too volatile D) substrate was a limiting factor
- if possible please post links used for summary a. Summarize and briefly explain the chemical interaction between EDC and NHS in Electrochemical Biosensing (CHEMICAL NAME: N-ethyl-N′-(3-(dimethylamino)propyl)carbodiimide/N-hydroxysuccinimide) b. Summarize and briefly explain the chemical interaction between Biotin & Avidin in Electrochemical BiosensingA nickel-containing transmembrane protein ___________. Select one: a. contains a cofactor and is found in the cytosol b. contains a cofactor and is found in the cell membrane c. is a dimer and is found in the cytosol d. contains a cofactor and is a dimer e. is a dimer and is found in the cell membraneIn reversed phase partition chromatography Select one: a. the least polar compound elutes first b. the smallest molecular weight compound elutes first c. the most polar compound elutes first d. the largest molecular weight compound elutes first e. the lowest boiling compound elutes first f. the highest boiling compound elutes first
- Why are there two MHCL variables?Surely that's a typo and the second is meant to be MMgOH(2) ?ondition wherein there is cholesterol deposition in the lamina propria of gallbladderA mixture of the follwoing compounds was separated by HPLC with a stationary nonpolar phase and a CH3OH/water mobile phase Which of the follwoing chromatograms would you expevt to botain? Explain your reasoning.
- Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)Supposing reagents for other Rh antigens are present and considering the nature of Rh Blood group antibodies, what additional step can be done to properly demonstrate the expected reaction using the forward slide method?Seperation of Amino Acids by thin layer chromotography Lab. Please answer #12 and #13 as I am very confused. Thank you for your help!