The UV-vis absorption spectrum of the peptide RYYFE collected in a 1 cm pathlength cuvette exhibits an absorbance of 0.050 at 280 nm. What is the concentration (in micromolar) of the peptide in this sample?

The UV-vis absorption spectrum of the peptide RYYFE collected in a 1 cm pathlength cuvette exhibits an absorbance of 0.050 at 280 nm. What is the concentration (in micromolar) of the peptide in this sample?

Organic Chemistry

8th Edition

ISBN:9781305580350

Author:William H. Brown, Brent L. Iverson, Eric Anslyn, Christopher S. Foote

Publisher:William H. Brown, Brent L. Iverson, Eric Anslyn, Christopher S. Foote

Chapter20: Dienes, Conjugated Systems, And Pericyclic Reactions

Section: Chapter Questions

Problem 20.26P

See similar textbooks

Related questions

Q: A natural products chemist isolated the sphingolipids shown at the right(alpha-GalCerBf) as the…

A: The measured mass or found mass of C40H78NO9-, C41H80NO9- and C42H82NO9- is 716.56860, 730.58393 and…

Q: A solution is prepared by dissolving 678 mg of testosterone in 20 mL of ethanol. The sample was…

Q: The ESI-MS spectrum in positive ionization mode for lysozyme is obtained. a. What is the molecular…

A: a) 1789.2 = (MW + nH+)n 1590.6 =[MW + (n+1)H+](n+1) n(1789.2) - nH+ = (n+1)1590.6 - (n+1)H+…

Q: Ex: A0.66 gram sample of L-(-)-menthof was dissolved in 13.3 mL of ethanol. The sample was then…

Q: Explain the differences observed in the T, and Tm values for each pair of polymers: (a) polyester A…

A: Given that, a)

Q: Fills in the blank using Mass spectrum Compound Name / ID: Base Peak: Base peak fragment…

A: Since you have posted a question with multiple sub-parts we will solve the first three for you. To…

Q: A solution of an unknown compound (3.0 g of the compound in 200 mL of solution), when placed in a…

A: Specific Rotation of the compound is calculated as follows: Since direction of polarized light is…

Q: Calculate the observed rotation a of D-erythrose at 25°C that would be observed in the polarimeter…

A: Specific rotation is a property of chiral or optically active compound and it is numerically equal…

Q: 2. The a chain of haptoglobin exhibits genetic polymorphism since glu- tamic acid can be replaced by…

A: 2)First, we will see the difference between the SDS and Native polyacrylamide gel electrophoresis…

Q: The electrospray ionization mass spectrum of the tripeptide Ala-Met-Thr shows peaks of…

A: Given peptide is: Ala-Met-Thr

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A: Introduction : Infrared spectroscopy is technique to identify the functional group of the molecule.…

Q: Brucine is a poisonous alkaloid obtained from Strychnos nux vomica, a tree that grows in India, Sri…

A: Figure 1

Q: A new protein of an unknown structure ha graphy (gel filtration) reveals that the native absence of…

A: Given: weight of native protein - 100 kDa dithiotreitol - 50 kDa

Q: The image below is a positive ionization mode Electrospray ionization-mass spectrum (ESI-MS)…

A: A multiple choice problem based on mass spectrum, which is to be accomplished.

Q: What strategy did McGregor & Hughes use to differentiate stereoisomers of nerolidol by GCXGC-MS?

A: When the molecules have the same bonding pattern of the groups besides having the same molecular…

Q: Which of the Allowing Paren thes) has the highest molor heat Cupacity in water? a) Glyeine (97A) 6)…

A: Heat capacity of a substance is defined as the amount of heat to be given to that substance of a…

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A: IR spectra helps us to find the different functional possibly present in the organic compound by its…

Q: What is the K, of the amino acid leucine if it is 34.5% disso- ciated at pH = 9.46? |3D

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: The 1H NMR for a dipeptide recorded in D20 is shown below. (i) Explain what has happened to the H-…

A: When molecules are placed in a strong magnetic field, the nuclei of some atoms will begin to behave…

Q: The negative ion mode electrospray ionization (ESI) mass spectrum of an oligonucleotide shows peaks…

Q: Which of the following can determine location of glysosidic linkages? A. Fractional analysis…

A: Fractional analysis using HPLC in tandem with MS HPLC stands for high performance liquid…

Q: In Kjeldahi analysis, a flour sample weighing 0.9857 was digested in concentrated H,So, for 45 min.…

A: Given the volume of 0.1011 N H2SO4 treated with NH3 extracted from the sample = 50.00 mL * (1L/1000…

Q: (P.Ç.1.2) Calculate the polydispersity index of a polymer than consisting of following molecular…

Q: Provide a multistep synthesis.

A: The above transformation involves reduction of ester to form aldehyde, methylation at alpha position…

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A: IR spectra deals results from the interaction of infrared radiation with matter by absorption. IR…

Q: Using the Beer-Lambert's Law, calculate the concentration of the riboflavin with an absorbance of…

Q: Use information from terminal residue analysis and partial hydrolysis to determine thestructure of…

A: An amino acid is a hydrocarbon that contains a carboxylic acid group, amino group along with R group…

Q: -CO̟ET `OAc OCH3 (i) dil aq. HCI, 70 °C Lipase PS, t-BUOCH,, 168 h OH он (S)-2 (iї) K-СОз, 168h OCH3…

A: Note: delta 6.8 - olefin region, delta 5.1 - hydrogen on carbon which is attached to oxygen, delta…

Q: Draw a structure for a peptide that gives Ala, Leu & Val on hydrolysis and fails to react with…

Q: Which separation technique is the most specific and offers the highest protein purification…

A: Chromatography is one the best technique for separation of molecules. It is based on the principle…

Q: Draw the electrophoretic separation of Trp, Cys, and His at pH 6.0.2

A: The electrophoretic separation of Trp, Cys, and His at pH 6.0 is given as,

Q: Identify the bonds in the Lidocaine which which correspond to the peaks 3243.36, 3021.31, 1661.66…

A: Given compound is Lidocaine And IR peaks: 3243.36, 3021.31, 1661.66 and 1491.42 cm-1

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

Q: There are almost 500 naturally occurring variants of hemoglobin. Hemoglobin X is a hemoglobin…

Q: 5. The purpose of SDS in SDS-PAGE is (a) to selectively bind the target protein. (b) to maintain…

A: SDS (sodium dodecyl sulphate) is an anionic detergent. SDS facilitates protein bifurcation. It…

Q: Which of the following technique/s can be used to determine the amino acid sequence of a polypeptide…

A: A technique of chemical sequencing is used for nucleolus-specific partial chemical modification of…

Q: The amino acid leucine has an Rf value of 0.73 and arginine has an Rf value of 0.20. Draw their…

A: Rf value is the ratio of distance travel by the solute to the distance travel by solvent from base…

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

Q: The Merrifield solid phase synthesis is commercially used for the production of peptides. Identify…

A: Unlike the translation machinery of lifeforms, Merrifield peptide synthesis starts from the…

Q: IIUne UI the above äre true 4. What is the starting point for selection of a suitable ion-exchange…

A: Proteins (or any biomolecules) are separated using ion-exchange chromatography based on changes in…

Q: Protein Z has an absorptivity (e) of 0.56 mL·mg1.cm 1 at 280 nm. You measure the absorbance at 280…

Q: 1) Compare between three steps for Kjeldahl method for determination of protein?I

A: INTRODUCTION: Kjeldahl method is defined as the method which is used for quantitative determination…

Q: 8. You are using mass spectrometry to determine the molecular weight of a peptide, which has…

A: The mass to charge ratio of ion is determine by mass spectroscopy.

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A: IR helps us to understand various possible functional group may present in the organic compound by…

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A: To find: The absorption, appearance, and compound for the IR spectra Statement: The stretching and…

Q: In SDS page, the elute from the column first. proteins will move through the gel fastest and first,…

A: SDS page and size exclusion chromatography are methods to separate proteins . In SDS page, charged…

Q: The monoanion of adenosine monophosphate (AMP) is an intermediate in phosphate metabolism: А—О—р—он…

A: It is given that pKa of the AMP-OH- anion is 7.21 and the ratio of the anion with its conjugate base…

Question

Extintion coeficient for Y is 1280

The UV-vis absorption spectrum of the peptide RYYFE collected in a 1 cm pathlength cuvette exhibits
an absorbance of 0.050 at 280 nm. What is the concentration (in micromolar) of the peptide in this
sample?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

The negative ion mode electrospray ionization (ESI) mass spectrum of an oligonucleotide shows peaks at the following m/z ratios: 2903.8 (40%), 2580.9 (67%) , 2323.7 ( 100 % ) , 2111.4 (71%), and 1935.7 (38%). What is the molecular weight of this molecule? Please show your calculations and use all peaks to determine significant figures.
whats the stracures of C6H11NO2 in HNMR spectrascupe
A stock solution of alcohol dehydrogenase (ADH) has been diluted 1 in 10 and the absorbance reading at 280 nm of this diluted solution is 0.04. Given that the absorption coefficient for ADH at 280 nm is e mg/ml = 1.6 and that you require to do 30 assays in triplicate, each assay using 2 ug of enzyme, how many ul of the stock ADH do you need to do the experiment?
The electrospray ionization mass spectrum of the tripeptide Ala-Met-Thr shows peaks of mono-protonation and di-protonation of the tripeptide. At what values of m/z would these peals be expected? Briefly explain and show your workings.
Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)
50 uL of an aqueous sample of double-stranded DNA is dissolved in 950uL of water. This diluted solution has a maximal absorbance of 0.326 at 260 nm. What isthe concentration of the original (more concentrated) DNA sample, expressed in ug/ul? I would like to know the process of this question. And I was wondering as well if the total diluted volume would be 950ul + 50ul = 1000ul
SHOW COMPLETE SOLUTIONS Q8. From 5 mL gDNA solution, 1 mL aliquot was diluted with sterile DNA gradevwater to a final volume of 5 mL. If the absorbance measured at A260 and A280 are 0.587 and 0.309, respectively (assuming that the solution is not turbid), what is the concentration of DNA sample in the original stock solution?
A natural products chemist isolated the sphingolipids shown at the right(alpha-GalCerBf) as the mixture of compounds that differed in their chain lengths. The structures shown, including the branching pattern, were determined NMR. The table below includes the found high-resolution masses of the three major isomers (negative mode,{M-H}-). Fill in the calcualted masses and the error ppm.
Calculate the concentration of a solution of peptide AWSME, in mM if the absorbance at 280 nm for the solution is 0.6 absorbance units, and a 0.2-cm cuvette is used. For the extinction coefficient, take into account that e280(Trp) = 5690 M-1 cm-1 and e280(Tyr) = 1280 M-1 cm-1. Round your answer to two decimals.
You obtained the following raw data when setting up a Biuret standard curve: BSA (mg/ml) Absorbancy 540nm 0 0.158 1 0.210 2 0.260 3 0.305 4 0.360 5 0.410 6 0.455 7 0.510 8 0.530 9 0.550 10 0.554 After blanking against a biuret-dH2O sample, the protein concentration of an unknown sample was determined using the same method and an absorbancy of 0.251 was obtained. Set up a standard curve, excluding outliers (experimental and statistical) and determine the protein concentration in the unknown sample in mg / ml (up to 3 significant figures).
50 uL of an aqueous sample of double-stranded DNA is dissolved in 950 uL of water. This diluted solution has a maximal absorbance of 0.326 at 260 nm. What is the concentration of the original (more concentrated) DNA sample, expressed in ug/uL?
Is both 2880 and 2970 sp3 C-H stretches?