d by the enzyme DNA polymerase. ack carried Questions RNA RNA is structural the sugar mo the nitroger replaces th Enzyme Function gyrase the polyr helicase DNA polymerase the poly • there 2 Explain why the replication of DNA is described as 'semi- transt conservative'. 3 In the experiment by Meselson and Stahl, described above: (a) If the bacteria were allowed to divide again, whilst in the same medium, what proportion of the DNA in the fourth generation would be hybrid, and what proportion would be light? (b) If the replication of DNA was dispersive, what would have been the results of the DNA composition after a second division of the bacteria? (c) In which parts of the DNA molecule is the 15N incorporated? Gen Ger Yo nu 4 Suggest where the free nucleotides that are in the nucleoplasm of nuclei in your cells have come from. 5 When, during the cell cycle, is mutation - an alteration to the nucleotide base sequence in a molecule of DNA - most likely to happen? some of the in replication: Copy and the table to the functions

d by the enzyme DNA polymerase. ack carried Questions RNA RNA is structural the sugar mo the nitroger replaces th Enzyme Function gyrase the polyr helicase DNA polymerase the poly • there 2 Explain why the replication of DNA is described as 'semi- transt conservative'. 3 In the experiment by Meselson and Stahl, described above: (a) If the bacteria were allowed to divide again, whilst in the same medium, what proportion of the DNA in the fourth generation would be hybrid, and what proportion would be light? (b) If the replication of DNA was dispersive, what would have been the results of the DNA composition after a second division of the bacteria? (c) In which parts of the DNA molecule is the 15N incorporated? Gen Ger Yo nu 4 Suggest where the free nucleotides that are in the nucleoplasm of nuclei in your cells have come from. 5 When, during the cell cycle, is mutation - an alteration to the nucleotide base sequence in a molecule of DNA - most likely to happen? some of the in replication: Copy and the table to the functions

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Describe the double-stranded structure of DNA, and explainhow the AT/GC rule underlies the ability of DNA to be replicatedsemiconservatively
Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
Several temperature-sensitive mutant strains of E. coli displaythe following characteristics. Predict what enzyme or functionis being affected by each mutation.(a) Newly synthesized DNA contains many mismatchedbase pairs.(b) Okazaki fragments accumulate, and DNA synthesis is nevercompleted.(c) No initiation occurs.(d) Synthesis is very slow.(e) Supercoiled strands remain after replication, which isnever completed.
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ______. a. phosphate-group transfers from ATP b. DNA polymerase c. the nucleotide itself d. a and c
(e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable?
Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Explain how rolling circle DNA replication allows both donor andrecipient to end up with a complete copy of plasmids transferredby conjugation.
Wild-type E. coli takes up and concentrates a certain redfood dye, making the colonies blood red. Transposonmutagenesis was used, and the cells were plated on fooddye. Most colonies were red, but some colonies did nottake up dye and appeared white. In one white colony, theDNA surrounding the transposon insert was sequenced,with the use of a DNA replication primer identical withpart of the end of the transposon sequence, and the sequence adjacent to the transposon was found to correspond to a gene of unknown function called atoE, spanning positions 2.322 through 2.324 Mb on the map(numbered from an arbitrary position zero). Propose afunction for atoE. What biological process could be investigated in this way, and what other types of white colonies might be expected?