Germline editing affects only somatic cells. True False
Q: An individual developed a condition characterized by progressive muscular weakness and aching muscle…
A: This shuttle functions in the transporting the fatty acids present in the cytosol to the…
Q: a) Which catalytic mechanism occurs in step 2? b) Why must phosphate first bind to succinyl-CoA…
A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Respiration is an oxidative…
Q: normone with its blood concentration inereased during physical
A: Growth Hormone is the hormone which increased with its blood concentration increased during physical…
Q: (8) B-ketothiolase is a multifunctional enzyme in lipid catabolism. Which of the following is NOT…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: What is the name of proteins that hold DNA in coils or V shapes in Bacteria?
A: SMC : SMC is structural chromosome maintenance .These complexes belongs to the family of ATPases…
Q: In the RBCs of the patient in the picture, which of the following would be expected? Explain. A.…
A: Red blood cells (RBCs) are the blood cells, which help to carry oxygen from the lungs to the tissues…
Q: 4. Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? What happens to…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Draw a Lineweaver-Burk plot for these data. Put both sets of data on the one graph, use a different…
A: If an enzyme follows Michaelis-Menten Kinetics, a plot of the reciprocal of the reaction velocity…
Q: Draw the dipeptide that results when a peptide bond is formed between the two glycine molecules…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: running the reaction at 83 °C cooling the reaction to 11 °C changing the pH to 5.4 Increase reaction…
A: The rate of an enzyme catalyzed reaction depends on various factors like temperature and pH of the…
Q: 2. Biosynthesis of thyroid hormones. Proteins: A. Thyroglobulin with DIT. B. Thyroglobulin with T C.…
A: As shown in the given figure, thyroid hormone synthesis occurs in following steps: iodide (I-)…
Q: a) Lock and key model versus induced fit model of enzyme activity. (b) Competitive and…
A: Introduction: All the biochemical reactions are enzymes catalyzed in a living organism. Enzymes are…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Q: A biological Claisen reaction occurs in the conversion of two acetyl CoA molecules to one…
A: Introduction: The condensation reactions involve the formation of new carbon-carbon bonds. The most…
Q: Please explain how did this reaction happened.
A: Molisch's test is a qualitative test used to detect the presence of carbohydrate in a sample. In the…
Q: Xanthoproteic Test (+) Millon's Test (-) Pauly Test (+) Biuret Test (-) Which peptide will yield the…
A: Polypeptides are amino acids linked together by peptide linkages.
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: Which polymerase transcribes genes with internal control regions (ICR)? ORNA Pol I RNA Pol III RNA…
A: DNA sequences located within the coding region of eukaryotic genes that bind regulatory elements…
Q: What is the difference between the two salt precipitation methods: salting in and salting out?…
A: The solubility of a protein in solution depends on the concentration of the salt present in…
Q: The table below summarizes the results for Millon's test. Provide the correct remarks from the…
A: The amino acid tyrosine has a side chain containing a phenol group.
Q: Consider an enzyme (P) that gets activated by forming a dimer (P2): 2P P2 At 25 °C, we have AH- 19…
A: ∆Ho is change in enthalpy of the protein activation= 19KJ/mol, it is the heat content of the given…
Q: Aldolase is a key enzyme in glycolysis that catalyzes the cleavage of its substrate,…
A: During glycolysis, Aldolase catalyzes the cleavage of its substrate fructose-1,6-bisphosphate into…
Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…
A: The activity of many proteins are modulated by post-translational modification of the proteins.
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Translation is a process of Synthesis of polypeptide chain from mRNA template by using Ribosomes. It…
Q: Fill out the table below. Determine whether the rate of the metabolic pathways will increase or…
A: Regulation of blood glucose is largely done by endocrine hormones , through a negetive feedback…
Q: Sample Results Remarks Glycine A Egg white B Casein Tyrosine D
A: In a polypeptide chain the amino acids are linked together via peptide linkages.
Q: the structure of a soap molecule, use the concept of intermolecular forces to explain why we use…
A: Soap molecules has hydrophilic head and a hydrophobic tail, they are composed of long chains of…
Q: 5. What molecules are missing from boxes in the gluconeogenesis reaction shown below 203PO- OPO,2…
A: H2O
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: Describe the roles of calcium in the cell, and the mechanisms that the cell uses to control…
A: Calcium is a vital nutrient that aids in the mineralization of the skeleton. Over 99 percent of the…
Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…
A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…
Q: HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Consider 41 NADH and 19 FADH, molecules funneling electrons into the electron transport chain…
A: Oxidative phosphorylation is the end point of energy-yielding metabolism in aerobic organisms. It…
Q: List down the specific functions of the component structures of mitochondrion relative to cellular…
A: The mitochondrion is a membrane-bound organelle. It is called as powerhouse of the cell, it plays a…
Q: water using concurrent exchange, rather
A: Maximum concentration of oxygen in blood as it leaves the Gill capillaries will be 50 mm Hg. Maximum…
Q: importance of nutrition
A: Nutrition is the biochemical process by which an organism eats a healthy and balanced diet through…
Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…
A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: Food is the source of macronutrients and micronutrients required for the body. During the process of…
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: c. Ribulose 5-phosphate levels would decrease. d. NADH to NAD+ ratios would decrease. e.…
A: In the RBC's of the patients certain changes are observed. Ribulose 5 Phosphate levels would…
Q: Explain the correlation between fasting and gluconeogenesis in terms of the hormone released by the…
A: From the non-carbohydrate source, glucose is synthesized called gluconeogenesis. It is a…
Q: 6. Describe the salient features and functions of phospholipids
A: Phospholipids or phosphatides are molecules which belong to the class of lipids has hydrophilic…
Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…
A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…
Q: Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication…
A: DNA replication is the particular process by which a specific molecule of DNA is being duplicated.…
Q: 3. Which of the following is not a part of relative substrate specificity? a) Group specificity b)…
A: Enzymes are proteins that assist the bodies speed up chemical processes. Enzymes act on substrate…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Step by step
Solved in 2 steps
- Information obtained by microscopic analysis of stained chromosomes is used in: radiation hybrid mapping sequence mapping RFLP mapping cytogenetic mappingGive only typing answer with explanation and conclusion Information: 1_Green Fluorescent Protein 2_nucleotide sequence, Amino acid sequence, and primers are obtained. 3_PCR protocol already described 4_bp has been calculations and estimated agarose gel image already designed. Questions: How do you analyze whether your target protein is expressed by E. coli cells. Explain your analysis method in detail and give information about the results you expect (in detail please)Indirect ELISA can detect polygenic gene expression. Rewrite this after correction.
- Northern blots are used to ________. map genomes detect gene expression isolate DNAPlease help and make it short. Also, please don't use advanced words when explaining, thanks! Explain how the mRNA vaccine work and relate to protein synthesis (Moderna and Pfizer vaccines are both using this technology).Do the mRNA covid-19 vaccine have safety issues and does the mRNA vaccine is not safe? I need full depth explanation for this question. Please help me with that.
- Define the following terms:a. transpositionb. transposable elementc. bacterial transformationd. transductione. conjugationHi, can you tell me which gene(s) are being mutated in humans due to hepatic exposure to high levels of PCB toxin? Thanks!!TRY TO KEEP IN SHORT AND USE OWN WORD FOR THIS QUESTION You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You subject two batches of the same bacteria type to different environmental growth conditions. One batch is grown at pH 2, while the other is grown at pH 7. All other environmental parameters are kept identical between the two batches. You then collect their proteins and run a Western blot using an antibody that binds to a proton efflux pump protein (which actively expends energy to pump protons out of a cell). How would you characterize the information obtained in this experiment? What does it tell you, and why is that potentially valuable information?
- Discuss about genetically modified tomato. What makes you support or oppose the use of it.Recombinant bacteria can produce hormones that are normally produced in humans. Briefly describe how this is accomplished.What can you advice to your fellow students to lessen the spreading of covid 19? ( 5 sentences please, Just type in your answer here, thank you!)
