HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that is covalently modified by glucose.  True  False

Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…

A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…

Q: но но- но он HN. он O Cerebroside O Sphingosine O Ganglioside O Ceramide

A: Cerebrosides are lipid complex , present in the sheaths of nerve fibers. Sphingosine forms a primary…

Q: During the treatment of hyperlipidemia, what is the metabolism of lipoproteins; and the mechanism of…

A: Hyperlipidemia refers to a high-level blood lipids like cholesterol (non-HDL cholesterol and LDL…

Q: Which of the following contain copper atoms (Cu2*) Select one: O a. Complex II O b. Complex III…

A: There are four enzyme complexes of ETC present in the inner mitochondrial membrane. Complex 1-…

Q: pyruvate in the glycolytic pathway build up slowing the pathway. Which of the following products may…

A: RBCs carry oxygen from the lungs to the rest of the body's cells. This oxygen is needed to generate…

Q: Which substrate is used in the last step of glycolysis?   Group of answer choices Glyceraldehyde…

A:

Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…

A: The Molisch's test, Fehling's test, and Bial's test are the qualitative tests for carbohydrates. In…

Q: Describe the roles of calcium in the cell, and the mechanisms that the cell uses to control…

A: Calcium is a vital nutrient that aids in the mineralization of the skeleton. Over 99 percent of the…

Q: The parasite Trypanosoma brucei, which causes sleeping sickness, uses proline as an energy source…

A: A transport mechanism that works to facilitate the movement of substances in and out of the cell…

Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…

A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…

Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA

Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…

A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…

Q: 1-How is a total cholesterol test different from a lipid panel?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: You are required to isolate, purify and verify the purity of an enzyme from cytosol of a plant

A: Enzymes are usually composed of proteins which is specific for its substrate. It has immense…

Q: The purpose of the carbohydrate in the food industry and its frequency of use

A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…

Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…

A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…

Q: What might be the dangers in using supplements to get DHA in your diet?

A: Docosahexaenoic acid (DHA) is an omega-3 fatty acid found in cold-water fish like tuna and salmon,…

Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…

A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…

Q: Second messenger in regulation of metabolism is: Select one: O a. hormones Оb. АТР neurotransmitters…

A: Secondary Messengers are the molecules that act as amplifying components in the cell signalling and…

Q: Introduction to urinary proteins and CSF proteins.

A: Protein is a highly complex molecule found in all living things. Proteins were identified as…

Q: The reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase involves two "sub-reactions", one…

A: A mole of NAD is reduced to NADH by glyceraldehyde phosphate dehydrogenase, resulting in…

Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…

A: Given  P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…

Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…

A: The qPCR is generally useful to determine the actual value of PCR product present at provided…

Q: Hello! Can you help me in determining the statements below if it's true or false? It's all about…

A: Lipids are organic compounds that are insoluble in water and soluble in organic solvents like ether…

Q: 1. Foods cannot be compared without determining the “per gram" values. Explain the reasoning behind…

A: Nutrients are substances required by the body, for the growth and development, reproduction, and to…

Q: a) Give an appraisal of prokaryote cell lines as recombinant polypeptide expression systems. (b)…

A: The bacterial expression system is widely used for the recombinant expression of mammalian proteins.…

Q: what transport proteins are involved is getting ca2+ out of cytosol

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: What kind of quality assessment is performed on amylase and why is this important? 2. What are the…

A: Amylase  comes under the glycoside hydrolase enzyme family that break down starch into glucose…

Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…

A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…

Q: Look at tho structuros of tho blood group dotorminante. Red blood cell N-Acetyl- D-glucosamine Blood…

A: Blood group antigens are O-glycoproteins, N-glycoproteins, and glycolipids that are present on the…

Q: Please explain where you would find glycosaminoglycans and what is the importance of these…

A: GAGs are negatively charged linear polysaccharides that are frequently found conjugated with…

Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…

A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…

Q: Question 3 Aldosterone regulates sodium, potassium, and chloride ions in tissues True False

A: Aldosterone is a hormone which is secreted by the adrenal glands. Aldosterone secretion is increase…

Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…

A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…

Q: 1. What are the major functions of lipids?

A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…

Q: 7. The standard free-energy change (in terms of net ATP production) when glucose is converted to 6…

A: All living organism except extremophiles metabolize carbohydrate particularly Glucose to meet up the…

Q: Match the non-Mendelian genetic terms with their descriptor. Genetic and environmental factors…

A: Genetic and environmental factors collectively influence a phenotypic expression  Answer-…

Q: Using specific examples, compare and contrast G-protein coupled receptors and nuclear receptors with…

A: The binding of signaling molecules to specific receptors and production of a cellular response…

Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…

A: 1. The first molecule in the biosynthesis of steroids that contain the…

Q: Which of the following is the primary method by which cyclin proteins are regulated to influence…

A: A. Transcriptional upregulation and translation followed by targeted ubiquitin-mediated degradation…

Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\

A: Retention factor The amount which each component of a mixture travels can be easily quantified using…

Q: Gold nanoparticles are applied in cancer therapy; approaches such as photothermal therapy as well as…

A: Photothermal therapy is the process of using electro magnetic radiation for treatment of cancer.…

Q: A physician diagnoses an infant patient with a pyruvate carboxylase deficiency in part by measuring…

A: In case of Pyruvate Carboxylase deficiency, body accumulates lactic acid in blood. This is an…

Q: How many ATP molecules are produced when 6 molecules of glucose enter glycolysis?

A: Glycolysis is a catabolic pathway in which six Carbon Glucose is catabolised into two 2carbon…

Q: In electron transport c Select one: О a. 1 АТР O b. 2ATP Ос. ЗАТР O d. None of the abe

A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…

Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…

A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…

Q: explain why the protein binding of the drug is not correlated with the distribution or elimination…

A: Many drugs form drug macromolecule complexes by interacting with plasma, tissue proteins, or other…

Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…

A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.

Q: How should you prepare your running buffer?

A: SDS-PAGE is method of separation of protein based on its size. Running buffer of the SDS-PAGE…

Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…

A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…