#6 2. What is the final messenger mRNA called? _ mature MRNA3. What two things are added to the messenger RNA?5'guanine and 3' poly-A tail4. What fragments are removed from the messenger RNA? iNtrons are removed by the pricess of5. Why are the poly A tail and methyl G cap important? t protects the 5' end of the MRNAfrom degradatioh.It also heips in the fransportation of MRNA from the hucieusthe cyt plasm and heips in the process of Finosome horng dunng the trans6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are notunderlined. Draw the final mature mRNA's (ready to leave the nucleus) below each pre-mRNA.a. AUGGGGCCCAAACCCCAGUUUUAAb. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAGc. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA(C) 2015 Bethany Lau.

Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…

(hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the final mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCOCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA

(hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the final mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCOCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
7. Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce proteins. Explain how RNA is involved in gene expression (i.e., in transcription and translation).
1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
1. The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______ The codon GGA would indicate which amino acid? _______ If a codon UAG is reached what does this indicate? _______
9) A hypothetical protein is 250 amino acids long how many nucleotides are in the code and sequence of the mRNA? A) 1000 B) 500 C) 1 million nucleotides D) 750 E) 1400
1. What would be the amino acid sequence encoded by the mRNA5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail? 220bp 295bp 140bp 435bp
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Control of gene expression in eukaryotic cells occurs at which level(s)? only the transcriptional level epigenetic and transcriptional levels epigenetic, transcriptional, and translational levels epigenetic, transcriptional, posttranscriptional, translational and posttranslational levels
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)
An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminal and carboxyl-terminal ends.