Answered: MAKE CONNECTIONS Speculate about…

MAKE CONNECTIONS Speculate about whether thesame enzyme could methylate both a histone and a DNAbase. (See Concept 5.4.)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter13: Genes, Chromosomes, And Human Genetics

Section: Chapter Questions

Problem 13TYK

See similar textbooks

Related questions

Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)

A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…

Q: 3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can…

A: The complete genome of E.coli is 5.44 million base pairs. The genome is replicated entirely in one…

Q: WHAT IF? Would you expect the plastid DNA of photosynthetic dinoflagellates, diatoms, and golden…

A: SAR is a supergroup that was proposed on the basis of the DNA (deoxyribonucleic acid) sequence…

Q: MAKE CONNECTIONS The restriction site for an enzymecalled PvuI is the following…

A: The enzyme that recognizes the specific and short sequence of nucleotides and cut at that site is…

Q: A terminator loop is… Group of answer choices a. A tertiary structure in DNA that causes DNA…

A: Introduction :- There are three main steps , that are present in any molecular events , like - in…

Q: Q Search For each statement, indicate if the statement applies to only eukaryotes, only prokaryotes,…

A: All the living organisms on earth can be classified as prokaryotes or euakryotes.

Q: ext, let's work through the 1st part of the process: TRANSCRIPTION. sing the sequence found in the…

A: The method of copying a part of DNA into RNA is known as transcription. Messenger RNA is made up of…

Q: econstruct the corresponding DNA template sequence from the partial mRNA sequence…

A: It is a double-stranded molecule made of nucleotides which are made from a nitrogenous/ organic…

Q: 5. Hypothetically speaking, a particular protein named GOTEAM is 1,000 amino acids and is known to…

A: Each amino acid is made up of 3 nucleotides. So, 1000 amino acid protein will be made up of 1000 X 3…

Q: es or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr…

A: The polymerase chain reaction (PCR) is an effective method for amplifying nucleic acids (DNA or RNA)…

Q: Yes or no? does rNTP's need to synthesize dsRMA? does rna seq allow to detect of splice…

A: rNTP is ribonucleoside triphosphate which is composed of a ribose sugar, 3 phosphate groups attached…

Q: primase The enzyme synthesizes the RNA primers required for DNA replication. Why are the RNA primers…

A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…

Q: 4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red…

A: The genetic information always flow from DNA to RNA to proteins. This flow of information is known…

Q: 2. If you mixed the mRNA of a human gene with thegenomic DNA for the same gene and allowed theRNA…

A: The binding of single standard DNA on the basis of their complementary is known as hybridization.…

Q: 1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger…

A: Since there are multiple questions in this particular question, I'll answer the first one for you.…

Q: Write down the major differences between DNA and RNA. Keeping in mind the concept of “central dogma…

A: Nucleic acids are the biopolymers or large biomolecules which is essential and important to all…

Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…

A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…

Q: MAKE CONNECTIONS Compare the CRISPR-Cas systemto the miRNA system discussed in Concept 18.3,…

A: CRISPR proteins form an enzyme called Cas9 enzyme the function of which is on recognizing the target…

Q: VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the…

A: An RNA primer initiates the synthesis of the leading strand and this should be removed and replaced…

Q: 6. Assume that you are working at a biotechnology company and you are assigned to a project in which…

A: Protein purification is a set of procedures for isolating a single or a few proteins from a…

Q: How does the mRNA Covid Vaccine work? Can it get into your DNA? What other mRNA vaccines have we…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the…

A: A typical eukaryotic gene is made up of exons (sequences that appear in mature mRNA) and introns…

Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…

A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'

Q: Integration of Lambda DNA requires

A: DNA (deoxyribonucleic acid) is a molecule made up of two polynucleotide chains that coil around each…

Q: Define `transcriptome'. Briefly describe the genome tiling array technology to `visualize'…

A: Hi dear, here's your answer what you want.can you please give me a like for this answer. * Every one…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: transduction.2. Explain how each of these three methods of genetransfer can be used to map bacterial…

A: The three methods or mechanisms of gene transfer in bacteria are: Transformation, Conjugation, and…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: GQ8 In a given problem, we are looking for a number between O and 255 that maximizes a profit…

A: Genetic Algorithm is generally used for finding the optimal solutions for the difficult problems as…

Q: Draw 4 total cycles of the thermal cycler. Begin with one original strand of DNA and show/explain…

A: *Thermal cycler is an laboratory apparatus used to amplify DNA segments through the polymerase chain…

Q: Q.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give…

A: The process of translation is the process of gene expression. This process is characterized by the…

Q: Yes or no? DAPI just stains dna in testes and sperm of planarian. A of riboprobe duryin situ…

A: Introduction :- DNA molecule acts as the genetic material of the cell and is made of polynucleotide…

Q: How might the knowledge in telomeres and telomerase be applied to anti-aging strategies? Are such…

A: To find The nature of telomere genetic material How telomere is applied to anti-aging Is strategy…

Q: MAKE CONNECTIONS Although the proteins that cause theE. coli chromosome to coil are not histones,…

A: The chromosomes are the densely packed DNA molecules that are found within the cells. The DNA is the…

Q: Explain briefly how bacteriophages causes mutation .

A: Bacteriophages (phages) are the most numerous organisms on the planet, yet very little learned…

Q: Fill in the gaps? One major goal/motivation in the development of synthetic genomes is ...... .…

A: In some ways, synthetic biology is similar to genome editing as both involve changes in the genetic…

Q: The double-stranded molecule of DNA: AG/TC is a very good representation of the much larger…

A: There are a total of 5 bases of which nucleic acids are made up that are Adenine (A), Thymine (T),…

Q: After Heat the mixture to separate mRNA and cDNA strands, and then eliminate the mRNA transcript.…

A: cDNA (complementary deoxyribonucleic acid) is a synthetic nucleic acid molecule synthesized in-vitro…

Q: 13. In your own words, identify one of the reasons why it is difficult to assemble a genome and…

Q: Review Figure 21.6 types of DNA sequences in the human genome. The lowest percentage of human genome…

A: The human genome contains different types of DNA ranging from exons to introns and non-coding…

Q: 3. Replicate the following segment of DNA. 5'-ATCGGCTACGTTCAC-3' 3'- TAGCCGATGCAAGTG-5'; and show…

A: Answer: Introduction: The semi-conservative replication means in which two copies of original DNA…

Q: Yes or no? for each gene, transcription is initiated at origin of replication. does pre mrna…

A: Transcription initiation site is called +1 initiation site. This segment of +1 initiation site is…

Q: Explain the- A Coherent Model- DNA Replication ?

A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…

Q: RNA: Check all that applies' * susceptible to UV damage. Used to transmit genetic information in…

A: Nucleic acids are polynucleotides of monomeric units or nucleotides, made up of three components: A…

Q: Q1: Explain the detailed structure of the DNA showing the deference between it and the RNA?

A: Hi! Thank you for the question, As per the honor code, we are allowed to answer one question at a…

Q: DNA ISOLATION IN FRUITS 1. How do you minimize the interaction between DNA and histones in the…

A: Introduction: The nucleosome complex of DNA folded over a histone protein octamer sorts out the…

Q: WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Question

MAKE CONNECTIONS Speculate about whether the
same enzyme could methylate both a histone and a DNA
base. (See Concept 5.4.)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Epigenetics

VIEW

DNA and Histone methylation

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

MAKE CONNECTIONS The restriction site for an enzymecalled PvuI is the following sequence:5’-CGATCG-3’3’-GCTAGC-5’
MAKE CONNECTIONS Although the proteins that cause theE. coli chromosome to coil are not histones, what propertywould you expect them to share with histones, given theirability to bind to DNA (see Figure 5.14)?
WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?
Describe briefly the nature of the genetic material 2. How might the knowledge in telomeres and telomerase be applied to anti-aging strategies? Are such strategies being developed?
transduction.2. Explain how each of these three methods of genetransfer can be used to map bacterial genes
Need help fast What length of DNA (based on the number of subunits) has a potential diversity close to 3 *10^16?
Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?
Give typed full explanation there are about 28,000 copies of zinc finger domains in the human genome, most of them as constituents of transcribed genes. This is a result of what process? Retro transposition of mobile sequences Evolutionary conservation, exon duplication and exon shuffling Evolutionary conversion of leucine zipper, helix-turn-helix, and helix-loop-helix domains into zinc finger domains Evolutionary selection for proteins that interfere with nucleosome packing Genes that “jump” with the help of a transposase.
Based on the data shown where is the DNA binding domain? Explain which constructs helped you reach this conclusion? Which part of the protein is the Activation domain? Explain which constructs helped you reach your conclusion?
5. Asap Repeated sequences can be classified according to theirorganization in the genome as well as according to theirfunction. Give at least two examples of each..
VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.
Fill in the gaps? One major goal/motivation in the development of synthetic genomes is ...... . Another branch of SB aims implementing ......... using biological building blocks is called ....... .