Answered: MAKE CONNECTIONS The restriction site…

Science

Biology

MAKE CONNECTIONS The restriction site for an enzymecalled PvuI is the following sequence:5’-CGATCG-3’3’-GCTAGC-5’

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 22QP: Analyzing Cloned Sequences What kind of information can a DNA sequence provide to a researcher...

See similar textbooks

Related questions

Q: 11. Here is a short stretch of replicating DNA. The top strand is the template. Assume the 4.... are…

A: In the multipart question, we are allowed to answer only 1st three subparts. Kindly repost the…

Q: what difficulty will you experience if you do genetic manipulation to streptomyces spp. and how can…

A: Streptomyces spp produces mainly actinomycins (for example streptomycin), tetracyclines,…

Q: Review transcription. Match the term and its description. Each term can only be used once. RNA…

A: RNa synthesis is catalyzed by the enzyme - RNA polymerase The DNA sequence where RNA polymerase…

Q: Q6) Why are ‘sticky ends’ useful biotechnologically? Q7) Why is this enzyme called a restriction…

A: When restriction enzymes cut between two bases on the same strand at one end of the sequence and two…

Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…

A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…

Q: A terminator loop is… Group of answer choices a. A tertiary structure in DNA that causes DNA…

A: Introduction :- There are three main steps , that are present in any molecular events , like - in…

Q: For each of the following items, describe what it is explain the necessity for each in cloning…

A: Genetic engineering is the application of technology in the manipulation of genetic information.…

Q: 8. Which reporter construct design would be best for moni IGFP green when, and how much a…

A: The promoter is the upstream region of the gene which enables the identification of the gene to be…

Q: econstruct the corresponding DNA template sequence from the partial mRNA sequence…

A: It is a double-stranded molecule made of nucleotides which are made from a nitrogenous/ organic…

Q: try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding…

A: The central dogma of molecular biology involves transportion and translation. the transgression is…

Q: intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA…

A: Ribonucleic acid (RNA) modifications refers to alteration in the chemical composition of ribonucleic…

Q: 3. Using the double stranded bacterial sequence provided below: ( - Indicate the promoter sequence…

A: All description given in this question though in brief transcription is a process where RNA produce…

Q: es or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr…

A: The polymerase chain reaction (PCR) is an effective method for amplifying nucleic acids (DNA or RNA)…

Q: Yes or no? does rNTP's need to synthesize dsRMA? does rna seq allow to detect of splice…

A: rNTP is ribonucleoside triphosphate which is composed of a ribose sugar, 3 phosphate groups attached…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: Yeast artificial chromosome how the synthesised?

A: Yeast artificial chromosome (YAC) is a human-engineered DNA molecule used to clone DNA sequences in…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material of the most of the organisms that carry coded…

Q: 11) Draw a bacterial expression vector with all required vector sequences. Be sure to label any…

A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to…

Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short…

A: The transcription is the process by which RNA is produced from the DNA template and the translation…

Q: MAKE CONNECTIONS Compare the CRISPR-Cas systemto the miRNA system discussed in Concept 18.3,…

A: CRISPR proteins form an enzyme called Cas9 enzyme the function of which is on recognizing the target…

Q: VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the…

A: An RNA primer initiates the synthesis of the leading strand and this should be removed and replaced…

Q: VISUAL SKILLS Describe what happens to the trp operon as the cell usesup its store of tryptophan

A: An operon is a group of genes and the promoter, including some more regulatory sequences. These…

Q: Remodeling complexes use the energy from ATPhydrolysis to change the position of…

A: Chromatin remodeling is the structural modification of chromatin to allow access of condensed…

Q: BIOLOGY 123, SPRING 2022 LAB STUD Q13. Using examples, explain why the genetic code is considered…

A: Q. Using examples, explain why the genetic code is considered redundant but not ambiguous.

Q: Pre-mRNA processing takes place in

A: EXPLANATION In bacteria, transcripts RNA are ready to function as messenger RNAs and translated into…

Q: asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the…

A: A typical eukaryotic gene is made up of exons (sequences that appear in mature mRNA) and introns…

Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…

A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'

Q: ZFNs What is it? And how it works in genome editing?

A: Zinc-finger nucleases are counterfeit limitation catalysts (artificial restriction enzyme) produced…

Q: Bob's telomerase works extremely well (10x better than the average humans). Explain the function of…

A: Telomerase is an enzyme. It maintains length of telomere by adding repetative sequence that are…

Q: 5. Describe the method of random mutagenesis using degenerate oligonucleotide primers 6. What are…

A: We are authorized to answer one question at a time since you have not mentioned which question you…

Q: transduction.2. Explain how each of these three methods of genetransfer can be used to map bacterial…

A: The three methods or mechanisms of gene transfer in bacteria are: Transformation, Conjugation, and…

Q: Draw 4 total cycles of the thermal cycler. Begin with one original strand of DNA and show/explain…

A: *Thermal cycler is an laboratory apparatus used to amplify DNA segments through the polymerase chain…

Q: r it 6- Complete the following: a) Two fragments of DNA can be joined by a b) Restriction enzymes…

A: Recombinant DNA technology is the process by which we can isolate our gene of interest and then…

Q: Question: how does the flu without the track arise and what does it mean male type splicing if the…

A: Flu first arrise from birds and animals then it transmitted into humans. It's spread from virus.…

Q: 5d. Remembering that hexose metabolism is a highly conserved process among all branches of life, how…

A: Hexose operon should contain 10 genes.

Q: Saration plasmids? 9. Predict and explain the effect of each of the following conditions on the Tm…

A: The Tm value is defined as the temperature at which half of the ds DNA is denatured . a) Now at pH…

Q: Nutritional requirements of white verses red yeast What is the differences in the ability of…

A: Yeasts are a type of fungi. Normal or wild-type yeast colonies are usually white in color. This…

Q: MAKE CONNECTIONS Although the proteins that cause theE. coli chromosome to coil are not histones,…

A: The chromosomes are the densely packed DNA molecules that are found within the cells. The DNA is the…

Q: Explain briefly how bacteriophages causes mutation .

A: Bacteriophages (phages) are the most numerous organisms on the planet, yet very little learned…

Q: 12. You are working with a picce of DNA of the sequence: 5'-TATTGAGCTCCCCGGAT-3…

A: Restriction enzymes cut DNA at a specific location called as restriction site.

Q: Fill in the gaps? One major goal/motivation in the development of synthetic genomes is ...... .…

A: In some ways, synthetic biology is similar to genome editing as both involve changes in the genetic…

Q: 13. In your own words, identify one of the reasons why it is difficult to assemble a genome and…

Q: Reset Help defined as changes in the sequence of Mutations DNA frameshift mutations caused by…

A: a- mutagens (mutations caused by environmental factors) d- carcinogens (mutagens include cancer…

Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C,…

A: A silent mutation is a change of the succession of nucleotide bases which establishes DNA, without a…

Q: MAKE CONNECTIONS Speculate about whether thesame enzyme could methylate both a histone and a…

A: Epigenetics is defined as the heritable and non-heritable changes that take place in the gene…

Q: DNA ISOLATION IN FRUITS 1. How do you minimize the interaction between DNA and histones in the…

A: Introduction: The nucleosome complex of DNA folded over a histone protein octamer sorts out the…

Q: MIRNA (Ca he 'seed region').. 3: what actually happened if Splicing factor mutated? Give an example…

A: In spliceosomes during post transcriptional modification introns are removed from the m RNA which…

Q: WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: 11) Draw a bacterial expression vector with all require vector sequences. Be sure to label any…

A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to…

Q: TALENs What is it? And how it works in genome editing? Including

Question

MAKE CONNECTIONS The restriction site for an enzyme
called PvuI is the following sequence:
5’-CGATCG-3’
3’-GCTAGC-5’

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

transduction.2. Explain how each of these three methods of genetransfer can be used to map bacterial genes
Q5) Restriction enzymes look for a very particular KIND OF sequence. What is that called. Give me an example of one.
MAKE CONNECTIONS Speculate about whether thesame enzyme could methylate both a histone and a DNAbase. (See Concept 5.4.)
Analyzing Cloned Sequences What kind of information can a DNA sequence provide to a researcher studying a disease-causing gene?
WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?
MAKE CONNECTIONS Mutagens are chemical andphysical agents that induce mutations in DNA (seeConcept 17.5). How does reduced ozone concentrationin the atmosphere increase the likelihood of mutationsin various organisms?
12e which genes that are normally found in a lambda genome would be deleted in your lambda vector? briefly explain why those lambda genes are normally delete it from your lambda phage being used as cloning vectors.
Q1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations on phage R17 coat gene and replicase gene translation and explain the logic of your answers: a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon. b. Mutations in the stem loop around the coat gene initiation codon that weakens the base-pairing in the stem loop. c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.
QNo.3 Why transgene copy number is a key concern for transgenic studies? Describe an efficient method for the estimation of copy number.(Genetic engineering).
Pls Help me. 2. If a selection assay be made to identify cells that have incorporated the recombinant DNA, what type of medium will be used? How will it work?
Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine
ASAP What would be the result of a mutation that caused a cell to express the telomerase enzyme?