Suppressor tRNA often carries a mutation that change the anti-codon to match the mutated codon. Propose two other examples, where mutation in a RNA could suppress the mutation in another RNA, one from eukaryotes and the other from prokaryotes. You must specify the names for the RNA or RNA elements and the process they play roles in RNA 1 RNA 2 process prokaryote eukaryote

Suppressor tRNA often carries a mutation that change the anti-codon to match the mutated codon. Propose two other examples, where mutation in a RNA could suppress the mutation in another RNA, one from eukaryotes and the other from prokaryotes. You must specify the names for the RNA or RNA elements and the process they play roles in RNA 1 RNA 2 process prokaryote eukaryote

Name: Suppressor tRNA often carries a mutation that change the anti-codon to
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Suppressor tRNA often carries a mutation that change the anti-codon to match the mutated codon. Propose two other examples, where mutation in a RNA could suppress the mutation in another RNA, one from eukaryotes and the other from prokaryotes. You mu

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G Cap aminoacyl tRNA synthetase proofreading elF4E [Choose ] Binds ribosome A site Translation initiation in eukaryotes Translation initiation in Bacteria binds mRNA cap in eukaryotes Binds ribosome E site Correct charging of a tRNA with amino acid Cap-independent translation initiation of some viral mRNAs [Choose ] [Choose ] [Choose ] [Choose ]
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
Name and describe three mechanisms of RNA processingin eukaryotes, and explain their importance to the cell.
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
Match the regulatory RNA to each of the following descriptions. Regulatory RNA that prevents transcription by recruiting DNMT enzymes Regulatory RNA that prevents translation by acting either in cis- or trans- but not by binding RISC Regulatory RNA found only in eukaryotes that is not perfectly complementary to the target RNA [Choose ] [Choose ] [Choose ] antisense RNA siRNA IncRNA miRNA riboswitch <
Several experiments were conducted to obtain information about how the eukaryotic ribosomerecognizes the AUG start codon. In one experiment, the gene that encodes the methionine initiatortRNA (tRNA,Met) was identified and changed. Specifically, the nucleotides that specify the anticodonon the tRNA,Met were mutated so that the anticodon in the tRNA was 5'-CCA-3'. When thismutated gene was introduced into a eukaryotic cell protein synthesis occurred, but the proteinsproduced were abnormal. Some of these proteins contained extra amino acids and others containedfewer amino acids than normal. a.) What is the normal anticodon for tRNA,Met? Show how this normal anticodon would interact with the codon for methionine in the mRNA. b.) What codon does the mutant anticodon bind? What amino acid is incorporated into the polypeptide chain? Show the interaction between the mutant anticodon and the amino acid codon and finally, What do the results described above indicate about how the ribosome…
Several experiments were conducted to obtain information about how the eukaryotic ribosomerecognizes the AUG start codon. In one experiment, the gene that encodes the methionine initiatortRNA (tRNA,Met) was identified and changed. Specifically, the nucleotides that specify the anticodonon the tRNA,Met were mutated so that the anticodon in the tRNA was 5'-CCA-3'. When thismutated gene was introduced into a eukaryotic cell protein synthesis occurred, but the proteinsproduced were abnormal. Some of these proteins contained extra amino acids and others containedfewer amino acids than normal. Explain why some of the proteins produced contained extra amino acids while otherscontained fewer amino acids than normal? e. If the same experiment had been conducted in bacterial cells, what results would youexpect? Explain.
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site Lysine Asparagine Threonine Glutamic Acid
The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair with both 5’ CUC 3’ and 5’ CUU 3’. Which of the following is consistent with this phenomenon? 1. The information provided is not accurate since only the 5’ CUC 3’ codon can complementary base pair with the 3’ GAG 5’ anticodon 2. This feature allows for the genetic code to be degenerate 3. This feature allows for the genetic code to be overlapping 4. This feature is commonly associated with tautomeric shifts 5. This feature causes a change in the encoded amino acid