The F integration site detemines the order of gene transfer in Hfrs thr thr thi thr thi pro pro pro gly lac lac his pur his pur his pur gal gal th gy his gal pur lac pro thr lac pur gal his gl tN thr pro pro lac pur gal his gly hi th H the thi pro thi pro lac lac his pur hi pur ga gai H Fartity tactor I Origin (first to enter) I Terminus (last to enter) gal his gy th thr pro lac pur gly his gal pur lac pro thr thi 312 FIGURE 5-14 The five E. col Hir strains shown each have different F plasmid insertion points and orientations. All strains have the same order of genes on the E col chromosome. The orientation of the F factor determines which gene enters the recipient cell frst. The gene closest to Two types of DNA transfer can take place the teminus enters last.

The F integration site detemines the order of gene transfer in Hfrs thr thr thi thr thi pro pro pro gly lac lac his pur his pur his pur gal gal th gy his gal pur lac pro thr lac pur gal his gl tN thr pro pro lac pur gal his gly hi th H the thi pro thi pro lac lac his pur hi pur ga gai H Fartity tactor I Origin (first to enter) I Terminus (last to enter) gal his gy th thr pro lac pur gly his gal pur lac pro thr thi 312 FIGURE 5-14 The five E. col Hir strains shown each have different F plasmid insertion points and orientations. All strains have the same order of genes on the E col chromosome. The orientation of the F factor determines which gene enters the recipient cell frst. The gene closest to Two types of DNA transfer can take place the teminus enters last.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

. In an effort to determine the location of an operator sitefor a negatively regulated gene, you have made a seriesof deletions within the regulatory region. The extent ofeach deletion is shown by the line underneath the sequence, and the resulting expression from the operon(i = inducible; c = constitutive; − = no expression) isalso indicated.... GGAT C T T AGCCGGCTAACATGATAAATATAA......C C T AGAATCGGCCGA TTGTA C T A TTT ATAT T ...1 i2 –3 c4 –5 ca. What can you conclude from these data about thelocation of the operator site?b. Why do you think deletions 2 and 4 show no expression of the gene?
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?
The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?
A pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has catalytic function.
Define the following terms:a. cohesinb. transcription factoryc. P bodiesd. CTCFe. ENCODE
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause a protein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has been deleted?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Scientists have exploited the siRNA pathway toperform a technique called RNA interference—ameans to knock down the expression of a specificgene without having to make mutations in it. Theidea is to introduce dsRNA corresponding to thetarget gene into an organism; the dsRNA is thenprocessed into an siRNA that leads to the degradation of the target gene’s mRNA. One clever methodfor delivery of the dsRNA to some organisms (thenematode C. elegans, for example) is to feed thembacteria transformed with a recombinant plasmidthat expresses dsRNA.a. Draw a gene construct that, when expressed from aplasmid in bacteria, could be used to knock downby RNA interference the expression of gene X ofC. elegans.b. How can you test if gene X expression is obliterated in worms that have eaten the bacteria transformed with a plasmid containing your construct?c. Do you think that only gene X expression will beaffected in these worms? Explain.
The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
The entire genome of the yeast Saccharomyces cerevisiaehas been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-sizesequences with appropriate translational initiation andtermination signals) in the genome. Some of these ORFsare previously known genes with established functions;however, the remainder are unassigned reading frames(URFs). To deduce the possible functions of the URFs,they are being systematically, one at a time, convertedinto null alleles by in vitro knockout techniques. The results are as follows:15 percent are lethal when knocked out.25 percent show some mutant phenotype (alteredmorphology, altered nutrition, and so forth).60 percent show no detectable mutant phenotype at alland resemble wild type.Explain the possible molecular-genetic basis of thesethree mutant categories, inventing examples wherepossible.