Answered: The GC content of the DNA in the genome…

Name: The GC content of the DNA in the genome of a newly discovered bacteriu
Uploaded: 2022-11-30T17:34:22.000Z
Channel: Bartleby
Description: The GC content of the DNA in the genome of a newly discovered bacterium is 46%, what is the percentage of Thymine in the genome this organism?

Science

Biology

The GC content of the DNA in the genome of a newly discovered bacterium is 46%, what is the percentage of Thymine in the genome this organism?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 17QP: Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?

See similar textbooks

Similar questions

For the following sequence, what is the approximate annealing temperature? 5'-AGCTACGATCAGGTCA-3'
How much buffer would you need to dilute a stock solution of DNA that is at a concentration of 150ug/ml to a final concentration of 8 ng/uL in 25 ml?
What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
In samples of DNA isolated from two unidentified species of bacteria, X andY, adenine makes up 32% and 17%, respectively, of the total bases. Whatrelative proportions of adenine, guanine, thymine, and cytosine would youexpect to find in the two DNA samples? What assumptions have you made?One of these species was isolated from a hot spring (64 °C). Which species ismost likely the thermophilic bacterium, and why?
Extrachromosomal DNA is critical to the antibiotic resistance found in microorganisms, how do these DNA elements account for this phenomena?
What is the concentration of a DNA solution with an OD260 measurement of 3.175 if 1OD unit at 260nm represents a DNA concentration of 50 g/mL? Write the correct units.
Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH? a. dark violet solution b. light violet solution c. blue solution d. colorless solution
Describe the function of the following reagents used in the DNA extraction procedure?a) Proteinase K b) 5M Nacl c) Isopropanol d) 1X TE Buffer
A typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?
The chromosome of the bacterium (prokaryote) Escherichia coli has a size of approximately 4,000 kilobases (kb) [one kilobase = 1,000 bases]. What length of DNA (B form) would be contained in it? How does this length compare to the average size and/or volume of this bacterium?
The oligonucleotide d-ATGCCTGACT was subjected to sequencing by Sanger’s dideoxy method, and the products were analyzed by electrophoresis on a polyacrylamide. Draw a diagram of the gel banding pattern obtained.
You have a 20 mg/ml of Ethidium bromide stock solution. You need to a final concentration of 2ug/ml into a Agarose solution to visualize DNA. What is the dilution factor? Give typing answer with explanation and conclusion