Which of the following is NOT regulated by glucagon?
Q: RESOLVE STRICTLY IN DIGITAL FORMAT, TO BE ABLE TO COPY TO WORD. THANK YOU Different varieties of…
A: The concetration of total alcohols and reducing sugar are two determined to be the important…
Q: Calculate the energy produced (in ATP molecules) achieved by complete oxidation of the hydrolysis…
A: Glycolysis involves the oxidation of mannose into pyruvate. Mannose enters glycolysis as…
Q: Which feature of protein folding is NOT accurate?
A: Proteins are large macromolecules and biomolecule that consists of one or more long chains of amino…
Q: Analyte Results Reference ranges total protein 9.40 g/dl 6.0 – 8.0 g/dl albumin OD=0.09, []=? 3.7…
A: Solve it by using Lambert beers law. Which states that Absorption is directly proportion to…
Q: ACTIVITY 6.2.4 Give the systematic name of the following cyclic monosaccharides: 1. Name: OH Н OH Н…
A: Monosaccharides are carbohydrates with single sugar unit. The structure of monosaccharides can be…
Q: Oils/Fatty acids have both a polar-head and a long tail that is non-polar. The term for a molecule…
A: Oils/Fatty acid structure consist of a head & a tail. The head is polar (hydrophilic) in nature…
Q: Frank weighs 112 kg and John weighs 56 kg. Both are exposed to 5 mGy of gamma radiation. Do they…
A: The dosage of radiation absorbed per kilogramme. The level of radiation does not mean anything in…
Q: Clinical significance of Hypouremia to BUN or urea
A: Hypo uremia - Uremia is s buildup of urea/toxins in our blood. then, Hypouremia is decrease in the…
Q: Which of the following describes a Z-DNA helix? a. It is inhibited by methylation of bases b. It is…
A: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a double…
Q: The enzyme malate dehydrogenase catalyzes the conversion of malate to oxaloacetate in the final step…
A: The malate dehydrogenase enzyme catalyzes the conversion of malate to oxaloacetate in the TCA cycle.…
Q: During glucagon signalling, one goal is to promote export of glucose from liver, In liver cells a…
A: Glucagon is a hormone secreted by the alpha cells in pancreas. It is a principle hormone that…
Q: Removal of phosphoryl groups is catalyzed by ___________ a. Diphteria toxin and cholera toxin b.…
A: The phosphoryl-transfer potential (the standard energy of hydrolysis) compares the proclivity of…
Q: Choose any/all that apply to lipids.
A: Lipids are biological macromolecules, insoluble in water/polar solvents but soluble in non-polar…
Q: ased on the knowledge you gained from the cloning module, which of the lanes in the urs is…
A: Agarose gel electrophoresis is used to separate DNA molecules based on their size and analyze DNA…
Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…
A: In the given data pKa of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…
Q: Which of the following is not a complex conjugated carbohydrate? O peptidoglycan O glycoprotein O…
A: Sugar molecules are carbohydrate molecules. Carbohydrates are one of three main nutrients found in…
Q: Draw, label, and explain the three stsges of lipid oxidation
A: Lipid peroxidation may be defined usually as a technique below which oxidants consisting of…
Q: On a mass basis, fats are more efficient sources of energy than carbohydrates but carbs may be…
A: Carbohydrates are the basic components of our food. It is organic compounds produced in the…
Q: a. Maltose contains 2 glucose units linked α1,4 and is a reducing sugar. i. True ii. False b.…
A: Maltose is derived from enzymatic hydrolysis of amylose.
Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…
A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…
Q: Which of the following CHÍNH, CH HO CHÁNH, CH₂OH I CH H₂N both a and b neither a nor b CHÍNH
A: Stereochemistry is also known as the subdiscipline of the chemistry. Stereochemistry involves the…
Q: henylalanine pell out the full name of the citric acid cycle Intermediate. If there ls more than one…
A: PKU patients can suffer from intellectual disabilities, brain damage, seizures, and other problems…
Q: Draw the structures of glucose, pyruvate, and acetyl coenzyme A; number (label) the carbons in each.
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: 1. What are the different classes of lipids? State their function and identify their chemical…
A: A group of organic compounds includes lipids that are insoluble or poorly soluble in…
Q: Enumerate the 3 Coronavirus strains that caused a large-scale outbreak in humans in the past 2…
A: Coronaviruse is basically a group of RNA viruses that can causes the serious complication to birds…
Q: Lactic acid fermentation is used to regenerate i. FADH2 ii. ATP iii. NADH iv. NAD'
A: The lactic acid produced in the muscle during lactic acid fermentation is transported to the liver,…
Q: 1. (a) The reaction catalyzed by citrate synthase is the first step of the TCA cycle. In glycolysis,…
A: The highly exergonic (energy releasing) reaction catalyzed by citrate synthase is given below
Q: a. Which of the following is NOT an example of structural polysaccharides? I. amylose II.…
A: Polysaccharides (polycarbohydrates) are the most common carbohydrate found in food. They are…
Q: Which enzyme activity of the glycogen debranching enzyme is operating during the release of glucose…
A: Enzyme are proteins or catalyst that help to speed up metabolism or chemical reaction in our body…
Q: ACTIVITY 6.2.7 Describe the common structural features and differences for each pair 1. Cellulose…
A: Glucose is referred as one of the most important sugar and this sugar is also present in blood. It…
Q: malate dehydrogenase is interconverted into isozymic forms by oxidizing and reducing agents
A: Malate dehydrogenase is found in a variety of organs in vertebrates. It has been discovered that…
Q: body fat muscle proteins carbohydrates fiber glycogen Fasting decreases the intake of body breaks…
A: Answer Fasting decreases the intake of carbohydrates which is needed for energy. Without this the…
Q: 135.) In the citric acid cycle, oxidoreductases are reversible. A) 0 of 4 B) 1 of 4 C) 2 of 4 D) 2…
A: The citric acid cycle oxidizes the acetyl Co-A into the carbon dioxide in the mitochondria. The…
Q: Propose a reasonable biosynthesis for compound 34 starting from acetyl CoA, alanine CoA, malonyl CoA…
A: Acetyl Co A is involved in my biochemical reactions (carbohydrate and lipid metabolism). It is a…
Q: 1 Specify the role each of the following amino acids play within the crystal structure and/or active…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: all dehydrogenase reactions are variations upon a theme. Within that set of reactions, all reactions…
A: Dehydrogenases is an enzyme belongs to the class of oxidoreductase enzyme. In oxidoreductase the…
Q: What is the difference between the first steps of DNA sequencing to PCR in terms of the number of…
A: PCR is expanded as a polymerase chain reaction. It is a technique that is used widely for the…
Q: Using four examples, describe the relationship between enzyme characteristics and the choice of…
A: Enzyme immobilization is confinement of enzyme to a phase one of a kind from the only for substrates…
Q: 1. Characterize BUN/Urea in terms of metabolism. 2. The clinical correlation of BUN and creatinine…
A: The kidneys are responsible for excreting waste products and toxins such as urea, creatinine, and…
Q: (a) What is the function of helicase in DNA replication? (b) What is the function of DNA polymerase?…
A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA replication…
Q: To set up a standard curve you would have had to set up a dilution series. Draw up a table showing…
A: Serial dilution is the process of converting a dense solution towards a more useable concentration…
Q: Long explanations are not needed. Direct answers would suffice. a. High concentration of glucose…
A: The glucose metabolism start with the process of glycolysis , the enzyme hexokinase is for…
Q: WHAT is the TOTAL NET YIELD of ATP (incl. ATP equivalents from NTPs, NADH, and FADH2) from the…
A: Aerobic oxidation of fatty acids includes beta oxidation of fatty acids and Krebs cycle thise are…
Q: 1.Describe briefly the concept of capillary electrophoresis and sate two ways that it is similar to…
A: Electrophoresis is a laboratory technique used to separate charged molecules like nucleic acids, and…
Q: Glycolysis is regulated primarily by _______________. a. three strongly exergonic, non-equilibrium…
A: The pathway that transform glucose to pyruvic acid is known as glycolysis. The free energy that is…
Q: Please explain the concept of a "feed-forward" mechanism and provide an example of this in the…
A: In a feed-forward activation, a metabolite produced early in the pathway activates the enzyme that…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Amino acids are monomers of protein they are linked with each other by forming…
Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?
A: Extracted DNA is generally stored in neutral pH.
Q: Design an experiment, using western blot, to test whether a certain amino acid sequence sends a…
A: Western blot is a method to detect the specific protein in the mixture of the proteins. In this…
Step by step
Solved in 2 steps
- In some forms of diabetes, a mutation in the b subunit of the insulin receptor abolishes the enzymatic activity of that subunit. How does the mutation affect the cell’s response to insulin? Can additional insulin (e.g., from injections) overcome the defect?Which of the following correctly describes the relationship between an enzyme and its function Glycogen phosphorylase: synthesis of glycogen Phosphate: removal of a phosphate group Adenylyl cyclase: conversion of cAMP to AMP Kinase: addition of a lyrosineThe epinephrine-mediated “amplificationcascade” of Figure 24.14 has six steps, all of which are catalyticwith one exception. This cascade leads to the activation of glycogenphosphorylase. This enzyme acts in turn on glycogen to yieldglucose-1-phosphate (G-1-P).(a) Which step is not catalytic?(b) If each catalytic step had a turnover (molecules of substrateacted on per molecule of enzyme) of 10, how many moleculesof G-1-P would result from one molecule of epinephrine?(c) What is the biochemical advantage of such a cascade?(d) How is the amplification cascade of this questionreversed?
- Diabetes Type 1 and Type 2 Applying signal transduction mechanisms in the context of Type I and Type II Diabetes. Describe the mechanisms by which a cell receives a message and translates it into short-term or long-term effects. Including the role of phosphorylation and feedback inhibition.Epinephrine stimulates glycogen breakdown by activating glycogen phosphorylase. However, in the research lab, no glycogen breakdown occurred when epinephrine was added to a test tube containing the enzyme and its substrate, glycogen. Explain why glycogen phosphorylase could be activated by epinephrine only when the hormone was added to intact cells in a solution.Glucagon The function of glucagon is in promoting energy release and inhibiting energy storage in response to low circulating glucose levels, which are largely controlled by insulin [24]. Besides its role in blood–glucose regulation, patients treated with glucagon receptor an tagonists (GRA) often suffer from dyslipidemia, fatty liver and weight gain, suggesting that glucagon play an important role in lipid metabolism [25]. Glucagon acts mainly on the hepatocytes which possess the highest level of glucagon receptors. Following mecha nisms may be involved during this process: (1) At the molecular level, following glucagon binding to its receptor on the hepatocyte, cAMP will be activated and accumulated, which in turn activates cAMP-response element-binding protein (CREB). As a result, the tran scription of carnitine acyl transferase (CPT-1) increases, which converts fatty acids into acylcarnitine and activates β-oxidation-increasing fatty acid catabolism [26]. In addition,…
- Insulin binding to its cellular receptor causes dimerization and phosphorylation of ( ) and assembly of a ( ) membrane transporter.What is NOT a second messenger? phosphatidylinositol 4,5-bisphosphate cyclic guanosine monophosphate diacylglycerol inositol 1,4,5-trisphosphate cyclic adenosine monophosphateOne such laboratory study investigated the binding of a hormone to three different receptor proteins in the cell membrane. The data collected are shown in the table below 1) Provide a brief explanation as to why ligand binding toproteins must be a reversible process. 2) Calculate the dissociation constant (Kd) for the hormone binding to each of the three proteins.
- Some strains of bacteria or microorganisms have developed toxins that can modify the activity of the alpha subunit of G proteins which results in disease. For ex. cholera toxin, produced by Vibrio cholerae, causes ADP ribosylation of the stimulatory Gαs subunit of G proteins. This modification abolishes the GTPase of Gαs, and results in an αs subunit that is always in the “on” or active state. It results in continuous stimulation of adenylyl cyclase (AC). The main cells affected by this are the epithelial cell in gastrointestinal tract. Knowing this altered activity of AC, explain why patients affected by this toxin experience severe diarrhea and dehydration that may result in death.Stimulation of a certain Gs protein–coupled receptor activates protein kinase A (PKA). Predict the eff ect of PKA activation on the following substrates of PKA: (a) acetyl-CoA carboxylase, (b) glycogen synthase, (c) hormone-sensitive lipase, and (d) phosphorylase kinase.In muscle cells, when adrenaline binds to beta-adrenergic receptor, it trigger signaling cascade leading to active glycogen phosphorylate breaks up glycogen into glucose subunits (Glycogen -> G1P). Base on following figure, describe this signaling cascade: