24. In recombinant DNA technology, genes are usually inserted into what form of DNA before being transferred into bacteria? - [ ] Teddy bear - [ ] Nucleus - [ ] Transposon - [ ] Ribosome - [ ] Plasmid 25. In PCR , what is happening at the denaturation step (94 )? - [ ] RNA polymerase creates a new RNA strand . - [ ] DNA strands come apart . - [ ] DNA polymerase creates a new DNA strand. - [ ] Primers bind to the target DNA. - [ ] Nucleotides bind to the primer .

24. In recombinant DNA technology, genes are usually inserted into what form of DNA before being transferred into bacteria? - [ ] Teddy bear - [ ] Nucleus - [ ] Transposon - [ ] Ribosome - [ ] Plasmid 25. In PCR , what is happening at the denaturation step (94 )? - [ ] RNA polymerase creates a new RNA strand . - [ ] DNA strands come apart . - [ ] DNA polymerase creates a new DNA strand. - [ ] Primers bind to the target DNA. - [ ] Nucleotides bind to the primer .

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 12TYK: Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to...

See similar textbooks

Similar questions

1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
110.Which of the following best explains the leading daughter DNA strand? A.The gaps within the leading strand are sealed by DNA ligase. B.The leading strand is synthesized by the enzyme primase. C.It is polymerized continuously by DNA polymerase from 5' - 3' direction. D. It is polymerized discontinuously by DNA polymerase from 5' - 3' direction which leaves gaps known as Okazaki fragments.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
How did Meselson and Stahl support Watson and Crick’s double-helix model? They demonstrated that each strand serves as a template tor synthesizing a new strand of DNA They showed that the DNA strands break and recombine without losing genetic material They proved that DNA maintains a doublehelix structure while undergoing semiconservative replication They demonstrated that conservative replication maintains the complementary base pairing of each DNA helix.
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
DNA polymerase III and DNA polymerase I are used in DNA replication in E. coli. What are their roles?
How did the scientific community learn that DNA replication takes place in a semi-conservative fashion?
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
How does the double helix structure of DNA support its role in encoding the genome? The sugar-phosphate backbone provides a template for DNA replication tRNA pairing with the template strand creates proteins encoded by the genome Complementary base pairing creates a very stable structure Complementary base pairing allows for easy editing of both strands of DNA.