You have identified a (fictional) gene C. This gene is thought to play a role in liking cold weather. You have the wild-type sequence of this gene. In talking to a coworker, you learn th he hates cold weather, so you ask to sequence- his gene C. When you get the sequence back, you realize he has a mutation in this gene. 1. Based on what you know about the genetic code, would a mutation in a gene always lead an altered protein? (Your answer should be specific to the genetic code and types of mutations that can occur in the genetic code.)

You have identified a (fictional) gene C. This gene is thought to play a role in liking cold weather. You have the wild-type sequence of this gene. In talking to a coworker, you learn th he hates cold weather, so you ask to sequence- his gene C. When you get the sequence back, you realize he has a mutation in this gene. 1. Based on what you know about the genetic code, would a mutation in a gene always lead an altered protein? (Your answer should be specific to the genetic code and types of mutations that can occur in the genetic code.)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 11QP: When the human genome sequence was finally completed, scientists were surprised to discover that the...

See similar textbooks

Similar questions

A molecule geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explai n how to obtain the desired gene.
In nature, the vast majority of individuals within a species have unique genetic codes. In the last few decades, human geneticists have discovered ways to artificially duplicate a genetic code. Two organisms with identical genetic codes might be the result ofA. CloningB. MutationC. Coevolution
Our bodies are not defenseless against mutagens that alter our genomic DNA sequences. What mechanisms are used to repair DNA?
What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?
When the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?
Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
Gene therapy is currently a fairly expensive treatment. For rare conditions, the fewer the people treated, the more expensive the treatment will be. But whatis the right price for a cure?
1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence