EBK GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260041255
Author: HARTWELL
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 6P
RNA shares with proteins the ability to fold into complex three-dimensional shapes. As a result, RNA molecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of molecules can act as enzymes, or biological catalysts). These statements are not true of DNA. Why can some RNA molecules act as enzymes whereas DNA molecules cannot? (Hint: Most RNA molecules consist of a single strand of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?
RNA shares with proteins the ability to fold into complex three-dimensional shapes. As a result, RNA molecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of molecules can act as enzymes, or biological catalysts). These statements are not true of DNA. Why can some RNA molecules act as enzymes whereas DNA molecules cannot?
What role does bonding play in DNA? Where are hydrogen bonds located? Where are covalent bonds located? Why is that significant to the overall structure and function of DNA
Chapter 1 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Ch. 1 - Choose the phrase from the right column that best...Ch. 1 - If one strand of a DNA molecule has the base...Ch. 1 - The size of one copy of the human genome is...Ch. 1 - Indicate whether each of the following words or...Ch. 1 - a. How many different DNA strands composed of 100...Ch. 1 - RNA shares with proteins the ability to fold into...Ch. 1 - The human protein lactate dehydrogenase shown in...Ch. 1 - a. Are the triplets in the genetic code table...Ch. 1 - Why do scientists think that all forms of life on...Ch. 1 - Why would a geneticist study a yeast cell or a...
Ch. 1 - How can a scientist tell if a protein present in...Ch. 1 - Figure 1.6 shows the amino acid sequences of parts...Ch. 1 - Why do scientists think that new genes arise by...Ch. 1 - Explain how the exon/intron structure of genes...Ch. 1 - Mutations in genes that change their pattern of...Ch. 1 - A single zebrafish gene function was inactivated...Ch. 1 - Different mutations in the WDR62 gene that...Ch. 1 - Researchers have successfully used gene therapy to...Ch. 1 - By the time this book is published, it will likely...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix has the following sequence: TTGGATGCTGG AACCTACGACC A. What would be the sequence of this double helix immediately after reaction with nitrous acid? Let the letter H represent hypoxanthine and U represent uracil. B. Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA was replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated twice? Your answer should contain the sequences of four double helices. Note: During DNA replication, uracil hydrogen bonds with adenine, and hypoxanthine hydrogen bonds with cytosine.arrow_forwardWhy is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA? Because it is entropically unfavorable Because that would cause a steric clash between the sugars and nucleobases Because that would cause a steric clash between the 2' OHs of the sugars and the phosphates Because uracil can't form hydrogen bonds with any other nucleobasesarrow_forwardIn a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with G or C? Explain in detail.arrow_forward
- why can we not describe the “average” behavior of a DNA molecule? Why is it improbable that proteins needed for DNA structure, for example, form spontaneously from random amino acids?arrow_forwardWhich of the following statements is correct? A. The 3’-end of a DNA double helix implies that both strands of the DNA helix have a free 3’- hydroxyl group on that end. B. DNA can form double helix while RNA cannot form double helix. C. Both A and B. D. Neither A nor B. The role of serine at the active site of serine proteases is to act as a(n) ________ catalyst, while the histidine residue serves as a(n) ________ catalyst. A. weak; strong B. acid-base; covalent C. anionic; ionic D. covalent; acid-base E. strong; weakarrow_forwardWhen DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′arrow_forward
- DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?arrow_forwardtrue or false: Hydrophobic interactions between bases are the primary stabilizing forces responsible for maintaining the DNA double helix.arrow_forwardthe human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During infection, however, HIV uses an enzyme known as reverse transcriptase to generate double-stranded DNA. Generally speaking, how would the enzyme generate a double strand of DNA from a single strand of RNA?arrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?arrow_forward. Which of the following statements best summarizes the differences between DNA and RNA? A) DNA is transcribed using RNA polymerase to form mRNA and mRNA is translated by the Ribosome to form a polypeptide, B) The bases in DNA contain sugars, whereas the bases in RNA do not contain sugar. C) DNA nucleotides contain a different glucose compared to RNA nucleotides. D) DNA is formed using the base uracil, whereas RNA uses the base thymine. E) DNA encodes the sequence of amino acids for the primary structure of a polypeptide whereas mRNA does notarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license