EBK GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260041255
Author: HARTWELL
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 15P
In Problem 14, cDNAs F and G could not be found in cDNA libraries (from any tissue) prepared using the method shown in Fig. 10.4. The reason is that the corresponding transcripts do not have poly-A tails.
| a. | Why is the lack of poly-A tails not surprising in light of your answer to part (d) of Problem 14? |
| b. | Why does the lack of poly-A tails present a difficulty for the method diagrammed in Fig. 10.4? |
| c. | Outline how you might adjust the protocol in Fig. 10.4 so as to find the cDNAs F and G annotated in the Genome Browser |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
This problem investigates issues encountered in sequencing the inserts in cDNA libraries.a. If you sequenced many clones individually, wouldn’tyou spend many of your resources inefficiently sequencing cDNAs for the same type of mRNA molecule over and over again? Explain. Does thisapparently inefficient process provide any useful information beyond the sequences of individual mRNAs?b. Suppose that you identified a clone with a cDNA insert that was 4 kb long. You could determine the entire sequence of the clone by shearing the DNA intosmall random fragments, cloning these fragments intoa vector to make a mini-shotgun library, and then sequencing hundreds of these clones to allow the computer to assemble the full sequence of the 4 kb–longinsert. However, this procedure would be inefficient.An alternative that requires many fewer sequencing reactions is called primer walking. This techniqueinvolves the synthesis of additional oligonucleotideprimers corresponding to cDNA sequences you…
A site-directed mutagenesis experiment was done on the catalytic triad of the serine protease subtilisin where all of the amino acids of the catalytic triad were mutated to alanine. The triple mutant enzyme was characterized kinetically and the mutant displayed a thousand-fold (103) rate enhancement over the uncatalyzed reaction. Explain the source of this rate enhancement. (The native wild-type subtilisin has a rate acceleration of 1010, when compared to the uncatalyzed reaction.)
E. coli strain BW25113 can grow on (D) Arg as the sole carbon source. A scientist working with you on this project has discovered that mice encode a protease that cancleave between (D)Arg‐(D)Arg. a. In a set of discrete steps outline how to construct this genomic library so that recombinant expression can be performed in E. coli
b. Once the genomic library has been constructed, describe in DISCRETE steps how you would isolate the DNA sequence that encodes for the protease that cleaves between (D)Ag-(D)Arg
Chapter 10 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Ch. 10 - Prob. 1PCh. 10 - List three independent techniques you could use to...Ch. 10 - Figure 10.2a has numbers indicating the...Ch. 10 - Which of the enzymes from the following list would...Ch. 10 - Prob. 5PCh. 10 - a. What sequence information about a gene is...Ch. 10 - Why do geneticists studying eukaryotic organisms...Ch. 10 - Consider three different kinds of human libraries:...Ch. 10 - The human genome has been sequenced, but we still...Ch. 10 - This problem investigates issues encountered in...
Ch. 10 - For the sake of simplicity, Fig. 10.4 omitted one...Ch. 10 - Give two different reasons for the much higher...Ch. 10 - Using a cDNA library, you isolated two different...Ch. 10 - The figure that follows shows part of a modified...Ch. 10 - In Problem 14, cDNAs F and G could not be found in...Ch. 10 - Fig. 10.10 presents a model for exon shuffling in...Ch. 10 - An interesting phenomenon found in vertebrate DNA...Ch. 10 - a. If you found a zinc-finger domain which...Ch. 10 - Prob. 19PCh. 10 - In the human immune system, so-called B cells can...Ch. 10 - Chimpanzees have a set of hemoglobin genes very...Ch. 10 - Complete genome sequences indicate that the human...Ch. 10 - On your computers browser, view the page accessed...Ch. 10 - Prob. 24PCh. 10 - Prob. 25PCh. 10 - Certain individuals with mild forms of...Ch. 10 - The 1 and 2 genes in humans are identical in their...Ch. 10 - Prob. 28P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′arrow_forwardAnother class of suppressor mutations, not describedin the chapter, are mutations that suppress missensemutations.a. Why would bacterial strains carrying such missense suppressor mutations generally grow moreslowly than strains carrying nonsense suppressormutations?arrow_forwardAfter Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forward
- After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNAarrow_forwardA recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?arrow_forwardThe IMD2 promoter contains three upstream transcription start sites (TSS) that are utilized under high GTP conditions and a single downstream TSS (-106) that is normally only utilized under low GTP conditions. In a wild type cell, expression of IMD2 mRNA only occurs if transcription initiates from the -106 TSS. In 300 words or less, describe: 1.) The normal function of Ssl2, and 2.) why a mutation in Ssl2, that increases its catalytic rate, would allow expression of the IMD2 ORF under high GTP conditions. (Conditions under which the IMD2 ORF is NOT expressed in the wild type.)arrow_forward
- Binding of a transcriptional activator to a promoter according to the Hill equation can be analyzed graphically by plotting the quantity f,([X*]) log10 1- f„([X']), versus log,,[X]. A. Show that this results in a linear relationship between dependent and independent variables and give the slope and intercept in terms of the Hill coefficient n and apparent dissociation constant K. B. Generate such linearized plots corresponding to hypothetical binding isotherms for the cases n = 1, 2, 3, 4 with K = 1:10-9 M.arrow_forwardA particular transposable element generates flanking direct repeats that are 4 bp long. Give the sequence that will be found on both sides of the transposable element if this transposable element inserts at the position indicated on each of the following sequences. a. Transposable element, a. 5'-ATTCGAACTGACCGATCA-3' b. b. Transposable element 5'-ATTCGAACTGACCGATCA-3'arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T→A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGCTGAGGCC ACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAGAATCCCCCACTCCAC ACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence www wwwtw ww Nar I GG/CGCC…arrow_forward
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardThe SARS-CoV-2 genome has a cap at its 5'-end that is the same as the one seen on most human mRNA molecules. The nsp12 RNA-dependent RNA polymerase acts like cellular RNA polymerase and initiates RNA synthesis by synthesizing a dinucleotide from two nucleoside triphosphates. What other enzymes are needed to add a cap to the nsp12 product? Describe the chemical nature of the products of each of these enzymesarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
An Introduction to the Human Genome | HMX Genetics; Author: Harvard University;https://www.youtube.com/watch?v=jEJp7B6u_dY;License: Standard Youtube License