Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 19P
Using the adenine
a. Give the sequence after a transition mutation.
b. Give the sequence after a transversion mutation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What would happen if any of the stages involved in the translation of DNA to protein were altered/irregular? What effect will this modification have on the protein?
A mutation occurred that changes the sequence of DNA from:
5’ACGTCATGGATAGTGCGTAAACTA3’
to
5’ACGTCATGCGATAGTGCGTAAACTA3’
Describe the effect of this mutation on the protein, and give the name of the type of mutation.
What process would be affected by the lack of the en- zyme RNA polymerase?
Chapter 11 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 11 - 11.1 Identify two general ways chemical mutagens...Ch. 11 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 11 - 11.3 What is the difference between a transition...Ch. 11 - What is the difference between a synonymous...Ch. 11 - 11.5 UV irradiation causes damage to bacterial...Ch. 11 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 11 - Researchers interested in studying mutation and...Ch. 11 - The effect of base - pair substitution mutations...Ch. 11 - Describe the purpose of the Ames test. How are...Ch. 11 - 11.10 In numerous population studies of...
Ch. 11 - 11.11 Two different mutations are identified in a...Ch. 11 - What is the phenotype effect of inserting a Ds...Ch. 11 - 11.13 Answer the following questions concerning...Ch. 11 - Several types of mutation are identified and...Ch. 11 - 11.15 A sample of the bacterium is exposed to...Ch. 11 - 11.16 A strain of is identified as having a null...Ch. 11 - Describe the difference between DNA transposons...Ch. 11 - 11.18 How are flanking direct repeat sequences...Ch. 11 - 11.19 Using the adeninethymine base pair in this...Ch. 11 - The partial amino acid sequence of a wild-type...Ch. 11 - Prob. 21PCh. 11 - 11.22 Many human genes are known to have homologs...Ch. 11 - The fluctuation test performed by Luria and...Ch. 11 - In this chapter, three features of genes or of DNA...Ch. 11 - Briefly compare the production of DNA double -...Ch. 11 - During mismatch repair, why is it necessary to...Ch. 11 - 11.27 Following the spill of a mixture of...Ch. 11 - 11.28 In an Ames test using Salmonella bacteria a...Ch. 11 - A wild - type culture of haploid yeast is exposed...Ch. 11 - A fragment of a wild - type polypeptide is...Ch. 11 - Prob. 31PCh. 11 - Alkaptonuria is a human autosomal recessive...Ch. 11 - 11.33 In an experiment employing the methods of...Ch. 11 - Using your knowledge of DNA repair pathways choose...Ch. 11 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 11 - A geneticist searching for mutations uses the...Ch. 11 - 11.37 In a mousebreeding experiment a new mutation...Ch. 11 - 11.38 Considering the Dumbo mutation in a Problem,...Ch. 11 - 11.39 Thinking back to the discussion of...Ch. 11 - 11.40 Common baker’s yeast () is normally grown at...Ch. 11 - 11.41 The two gels illustrated below contain...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which features do insertion sequences and transposons have incommon?arrow_forwardIf a DNA sequence (exons and introns) and the regions upstream/downstream are normal -- but no mRNA is produced -- what could cause the result?arrow_forwardContrast the structures ofretrotransposons and DNA transposons.arrow_forward
- What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.arrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardIf the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forward
- Our bodies are not defenseless against mutagens that alter our genomic DNA sequences. What mechanisms are used to repair DNA?arrow_forwardA molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.arrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
- Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardWhich class of mutation, missense or nonsense, is morecommon, and why?arrow_forwardA mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License