Genetic Analysis: An Integrated Approach (3rd Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 11, Problem 36P

A geneticist searching for mutations uses the restriction endonucleases SmaI and PvuII to search for mutations that eliminate restriction sites. SmaI will not cleave DNA with CpGmethylation. It cleaves DNA at the restriction digestion sequence

Chapter 11, Problem 36P, A geneticist searching for mutations uses the restriction endonucleases SmaI and PvuII to search for , example  1

5'-CCC GGG-3'

3'-GGG CCC-5'

Chapter 11, Problem 36P, A geneticist searching for mutations uses the restriction endonucleases SmaI and PvuII to search for , example  2

PvuII is not sensitive to CpG methylation. It cleaves DNA at the restriction sequence

Chapter 11, Problem 36P, A geneticist searching for mutations uses the restriction endonucleases SmaI and PvuII to search for , example  3

5'-CAG CTG-3'

3'-GTC GAC-5'

Chapter 11, Problem 36P, A geneticist searching for mutations uses the restriction endonucleases SmaI and PvuII to search for , example  4

a. What common feature do SmaI and PvuII share that would be useful to a researcher searching for mutations that disrupt restriction digestion?

b. What process is the researcher intending to detect with the use of these restriction enzymes?

c. Explain why CpG dinucleotides are hotspots of mutation.

Blurred answer
Students have asked these similar questions
A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb.  When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated.  Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb.  Draw the restriction map for the 10 kb fragment based on the data.  Label the cut sites for the two enzymes, and the lengths between the cut sites.
When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above

Chapter 11 Solutions

Genetic Analysis: An Integrated Approach (3rd Edition)

Ch. 11 - 11.11 Two different mutations are identified in a...Ch. 11 - What is the phenotype effect of inserting a Ds...Ch. 11 - 11.13 Answer the following questions concerning...Ch. 11 - Several types of mutation are identified and...Ch. 11 - 11.15 A sample of the bacterium is exposed to...Ch. 11 - 11.16 A strain of is identified as having a null...Ch. 11 - Describe the difference between DNA transposons...Ch. 11 - 11.18 How are flanking direct repeat sequences...Ch. 11 - 11.19 Using the adeninethymine base pair in this...Ch. 11 - The partial amino acid sequence of a wild-type...Ch. 11 - Prob. 21PCh. 11 - 11.22 Many human genes are known to have homologs...Ch. 11 - The fluctuation test performed by Luria and...Ch. 11 - In this chapter, three features of genes or of DNA...Ch. 11 - Briefly compare the production of DNA double -...Ch. 11 - During mismatch repair, why is it necessary to...Ch. 11 - 11.27 Following the spill of a mixture of...Ch. 11 - 11.28 In an Ames test using Salmonella bacteria a...Ch. 11 - A wild - type culture of haploid yeast is exposed...Ch. 11 - A fragment of a wild - type polypeptide is...Ch. 11 - Prob. 31PCh. 11 - Alkaptonuria is a human autosomal recessive...Ch. 11 - 11.33 In an experiment employing the methods of...Ch. 11 - Using your knowledge of DNA repair pathways choose...Ch. 11 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 11 - A geneticist searching for mutations uses the...Ch. 11 - 11.37 In a mousebreeding experiment a new mutation...Ch. 11 - 11.38 Considering the Dumbo mutation in a Problem,...Ch. 11 - 11.39 Thinking back to the discussion of...Ch. 11 - 11.40 Common baker’s yeast () is normally grown at...Ch. 11 - 11.41 The two gels illustrated below contain...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License