Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11, Problem 26ESP
Summary Introduction
To design: An experiment to establish the fact that
Introduction: Taylor, Woods, and Hughes experiment demonstrated the semiconservative mode of DNA (deoxyribonucleic acid) replication in the root tips of plant Vicia faba.
Summary Introduction
To draw: Sister chromatids and demonstrate the expected results of conservative mode of DNA replication.
Introduction: The process of replication can be monitored by labeling DNA with 3H-thymidine using autoradiography. It is a common technique that pinpoints the location of a radioisotope in a cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What are the three models of DNA replication? With the aid of illustrations, show how the Meselson Stahl experiment come to the conclusion of one model of DNA replication.
Is DNA replication bidirectional? How did you arrive at this conclusion? Explain the bacterial replication model that supports this conclusion.
You conducted an experiment to determine the mechanism of DNA replication in the hypothetical organism Fungus mungus. Your data shows that synthesis of newly replicated DNA from F. mungus is discontinuous on both strands of the replication fork. Does this result support or not support the hypothesis that F. mungus replicates its DNA by the same mechanism as yeast?
Briefly explain your answer.
Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?
Chapter 11 Solutions
Concepts of Genetics (12th Edition)
Ch. 11 - In the Meselson-Stahl experiment, which of the...Ch. 11 - An alien organism was investigated. When DNA...Ch. 11 - Why might mutations in genes encoding telomerase...Ch. 11 - Although the brother is an immunologically matched...Ch. 11 - Prob. 3CSCh. 11 - HOW DOWE KNOW? In this chapter, we focused on how...Ch. 11 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 11 - Compare conservative, semiconservative, and...Ch. 11 - Describe the role of 15N in the MeselsonStahl...Ch. 11 - Predict the results of the experiment by Taylor,...
Ch. 11 - What are the requirements for in vitro synthesis...Ch. 11 - In Kornbergs initial experiments, it was rumored...Ch. 11 - How did Kornberg assess the fidelity of DNA...Ch. 11 - Which characteristics of DNA polymerase I raised...Ch. 11 - Kornberg showed that nucleotides are added to the...Ch. 11 - What was the significance of the polA1 mutation?Ch. 11 - Summarize and compare the properties of DNA...Ch. 11 - List and describe the function of the ten subunits...Ch. 11 - Distinguish between (a) unidirectional and...Ch. 11 - List the proteins that unwind DNA during in vivo...Ch. 11 - Define and indicate the significance of (a)...Ch. 11 - Outline the current model for DNA synthesis.Ch. 11 - Why is DNA synthesis expected to be more complex...Ch. 11 - Suppose that E. coli synthesizes DNA at a rate of...Ch. 11 - Several temperature-sensitive mutant strains of E....Ch. 11 - While many commonly used antibiotics interfere...Ch. 11 - Describe the end-replication problem in...Ch. 11 - Many of the gene products involved in DNA...Ch. 11 - In 1994, telomerase activity was discovered in...Ch. 11 - The genome of D. melanogaster consists of...Ch. 11 - Prob. 26ESPCh. 11 - DNA polymerases in all organisms add only 5...Ch. 11 - Assume that the sequence of bases shown below is...Ch. 11 - Reiji and Tuneko Okazaki conducted a now classic...Ch. 11 - Consider the drawing of a dinucleotide below. (a)...Ch. 11 - To gauge the fidelity of DNA synthesis, Arthur...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- List and describe the steps in prokaryotic DNA replication. How does this process appear to differ from eukaryotic DNA replication?arrow_forwardSuppose that 28% of the nucleotides in a DNA moleculeare deoxythymidine 5′- monophosphate, and that duringDNA replication the percentage amounts of availablenucleotide bases are 22% A, 22% C, 28% G, and 28% T.Which base would be depleted first in the replicationprocess?arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
- a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated from the two tissue types, to be the same? Why? b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regard to their origin (s) of replication.arrow_forwardWhen DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative modelarrow_forwardAssume that a certain bacterial chromosome has one origin of replication. Under some conditions of rapid cell division, replication could start from the origin before the preceding replication cycle is complete. How many replication forks would be present under these conditions?arrow_forward
- Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures of E. coli and equilibrium density gradient centrifugation. Draw pictures to represent the bands produced by bacterial DNA in the centrifuge tube before the switch to medium containing 14N and after one, two, and three rounds of replication in that medium. Use separate sets of drawings to show the bands that would appear if replication were (a) semiconservative; (b) conservative; (c) dispersive.arrow_forwardWhat would Meselson and Stahl have seen after 1,2, and 3 generations of replication if the dispersive model of DNA replication were correct?arrow_forwardThe Meselson-Stahl experiment provided strong evidence that DNA replication was conservative, by alternately growing bacteria in medium with heavy 15N and light 14N. If DNA replication were dispersive, what result would Meselson and Stahl have observed after the first round of DNA replication in light nitrogen? Group of answer choices Two bands, one at the location for pure 15N and one at the location for pure 14N. One band, located half way between the locations for pure 15N and pure 14N. Two bands, one at the location for pure 15N and one located halfway between the locations for pure 15N and pure 14N. None of these Three bands, one at the location for pure 15N, one at the location for pure 14N, and one at a location halfway between.arrow_forward
- With illustrative diagrams, explain the three theories of DNA replication..arrow_forward. Draw a replication bubble with both replication forksand label the origin of replication, the leading strands,lagging strands, and the 5′and 3′ ends of all strandsshown in your diagram.arrow_forwardexplain the term semiconservative replication?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license