Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 19PDQ
Suppose that E. coli synthesizes DNA at a rate of 100,000
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Suppose DNA polymerase synthesizes DNA at a rate of 1130 bases per minute in a new strain of E. coli. It takes the new strain 40 minutes to replicate their chromosome. How many nucleotides are in the chromosome? Calculate the length of the chromosome given the diagram.
A medium-sized human chromosome contains about 100 millionbp. If the DNA were stretched out in a linear manner, how longwould it be?
In the DNA model, what are the features that contribute to the stability and the ability of the DNA to replicate faithfully?
Chapter 11 Solutions
Concepts of Genetics (12th Edition)
Ch. 11 - In the Meselson-Stahl experiment, which of the...Ch. 11 - An alien organism was investigated. When DNA...Ch. 11 - Why might mutations in genes encoding telomerase...Ch. 11 - Although the brother is an immunologically matched...Ch. 11 - Prob. 3CSCh. 11 - HOW DOWE KNOW? In this chapter, we focused on how...Ch. 11 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 11 - Compare conservative, semiconservative, and...Ch. 11 - Describe the role of 15N in the MeselsonStahl...Ch. 11 - Predict the results of the experiment by Taylor,...
Ch. 11 - What are the requirements for in vitro synthesis...Ch. 11 - In Kornbergs initial experiments, it was rumored...Ch. 11 - How did Kornberg assess the fidelity of DNA...Ch. 11 - Which characteristics of DNA polymerase I raised...Ch. 11 - Kornberg showed that nucleotides are added to the...Ch. 11 - What was the significance of the polA1 mutation?Ch. 11 - Summarize and compare the properties of DNA...Ch. 11 - List and describe the function of the ten subunits...Ch. 11 - Distinguish between (a) unidirectional and...Ch. 11 - List the proteins that unwind DNA during in vivo...Ch. 11 - Define and indicate the significance of (a)...Ch. 11 - Outline the current model for DNA synthesis.Ch. 11 - Why is DNA synthesis expected to be more complex...Ch. 11 - Suppose that E. coli synthesizes DNA at a rate of...Ch. 11 - Several temperature-sensitive mutant strains of E....Ch. 11 - While many commonly used antibiotics interfere...Ch. 11 - Describe the end-replication problem in...Ch. 11 - Many of the gene products involved in DNA...Ch. 11 - In 1994, telomerase activity was discovered in...Ch. 11 - The genome of D. melanogaster consists of...Ch. 11 - Prob. 26ESPCh. 11 - DNA polymerases in all organisms add only 5...Ch. 11 - Assume that the sequence of bases shown below is...Ch. 11 - Reiji and Tuneko Okazaki conducted a now classic...Ch. 11 - Consider the drawing of a dinucleotide below. (a)...Ch. 11 - To gauge the fidelity of DNA synthesis, Arthur...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardIn the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one light strand and one heavy strand ("hybrid") after one generation of growth in medium containing 14N? After two generations of growth in a medium containing 14N? What fraction of hybrid DNA is expected after n generations of growth in a medium containing 14N?arrow_forwardWhen DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative modelarrow_forward
- The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be made in one round of DNA replication in a bacterial population containing 1000 bacteria?arrow_forwardA. In NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for DNA replication? B. In NOT more than 200 words, explain the special mechanism used to replicate chromosome ends?arrow_forwardAssume that a cycle of the polymerase chain reaction takes 20 minutes. How many copies of a single DNA fragment will there be after the reaction has been run for six hours?arrow_forward
- A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a replication fork is 100,000 nucleotides per minute, how much time will theta replication require to completely replicate the molecule, assuming that theta replication is bidirectional? How long will replication of this circular chromosome by rolling-circle replication take? Ignore replication of the displaced strand in rolling-circle replication.arrow_forwardGiven the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?arrow_forwardWhat results would be expected in the experiment outlined in Figure if, during replication, all the original histone proteins remained on one strand of the DNA and new histones attached to the other strand?arrow_forward
- You conducted an experiment to determine the mechanism of DNA replication in the hypothetical organism Fungus mungus. Your data shows that synthesis of newly replicated DNA from F. mungus is discontinuous on both strands of the replication fork. Does this result support or not support the hypothesis that F. mungus replicates its DNA by the same mechanism as yeast? Briefly explain your answer.arrow_forwardDoes E. coli chromosomal replication always start at one particular site? What is called? If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts? What is the end of E. coli chromosome replication?arrow_forwardSuppose that 28% of the nucleotides in a DNA moleculeare deoxythymidine 5′- monophosphate, and that duringDNA replication the percentage amounts of availablenucleotide bases are 22% A, 22% C, 28% G, and 28% T.Which base would be depleted first in the replicationprocess?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license