Essentials of Genetics, Books a la Carte Plus Mastering Genetics with eText -- Access Card Package (9th Edition)
9th Edition
ISBN: 9780134319070
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 1PDQ
HOW DO WE KNOW?
In this chapter, we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions:
(a) How did we determine the compositions of codons encoding specific amino acids?
(b) How were the specific sequences of triplet codes determined experimentally?
(c) How were the experimentally derived triplet codon assignments verified in studies using bacteriophage MS2?
(d) How do we know that mRNA exists and serves as an intermediate between information encoded in DNA and its concomitant gene product?
(e) How do we know that the initial transcript of a eukaryotic gene contains noncoding sequences that must be removed before accurate translation into proteins can occur?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
As we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions:
Question: How do we know that the initial transcript of a eukaryotic gene contains noncoding sequences that must be removed before accurate translation into proteins can occur?
The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
Chapter 12 Solutions
Essentials of Genetics, Books a la Carte Plus Mastering Genetics with eText -- Access Card Package (9th Edition)
Ch. 12 - CASE STUDY | A drug that sometimes works A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 12 - Review the Chapter Concepts list on p. 215. These...Ch. 12 - In studies of frameshift mutations, Crick,...Ch. 12 -
4. The mRNA formed from the repeating...Ch. 12 - In studies using repeating copolymers, AC......Ch. 12 - Prob. 6PDQCh. 12 - Prob. 7PDQ
Ch. 12 -
8. When the amino acid sequences of insulin...Ch. 12 - Prob. 9PDQCh. 12 - Why doesn't polynucleotide phosphorylase (Ochoa's...Ch. 12 - Refer to Table 12.1. Can you hypothesize why a...Ch. 12 -
12. Predict the amino acid sequence produced...Ch. 12 - A short RNA molecule was isolated that...Ch. 12 - A glycine residue exists at position 210 of the...Ch. 12 - Shown here is a theoretical viral mRNA sequence...Ch. 12 -
16. Most proteins have more leucine than...Ch. 12 - Define the process of transcription. Where does...Ch. 12 - Describe the structure of RNA polymerase in...Ch. 12 - In a written paragraph, describe the abbreviated...Ch. 12 - Messenger RNA molecules are very difficult to...Ch. 12 - One form of posttranscriptional modification of...Ch. 12 - In a mixed copolymer experiment, messages were...Ch. 12 -
23. Shown in this problem are the amino acid...Ch. 12 - Alternative splicing is a common mechanism for...Ch. 12 - The genetic code is degenerate. Amino acids are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- During planetary exploration a new life form is discovered which has a DNA genome containing 6 different bases rather than the familiar four. The life form contains proteins with 25 different amino acids. Codons on Earth comprise three nucleotides; assuming a non-overlapping genetic code that includes initiation and termination codons, how many nucleotides would you predict to constitute a codon in the new life form, assuming all codons to be the same length? Briefly explain your answer.arrow_forwardSickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forwardThe genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lysarrow_forward
- What is the biological significance of the extensive degeneracy of the genetic code?arrow_forwardI are studying pancreatic islet cells and have isolated, cloned, and sequenced a novel protein that you postulate has 4 transmembrane segments. Explain why the sequence would lead to this hypothesis (what procedure would I have applied).arrow_forwardAs we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimental information verifies that certain codonsin mRNA specify chain termination during translation?arrow_forward
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardHow does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to attach the proline to?Question 24 options: A) the synthetase recognizes the sequence of the first 3 bases on the 3' end of the tRNA B) the synthetase reads the anticodon as well as a few other unique bases in tRNAPro C) proline only fits into the 3-dimensional structure of the tRNAPro D) the synthetase randomly chooses a tRNAarrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forward
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.arrow_forwardUsing a table that shows which codon represents which amino acid determine the following:  A) The possible codons that encode Serine:  B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases:  C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases:  D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:arrow_forwardAs we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimentally derived information led to Holley’sproposal of the two-dimensional cloverleaf model of tRNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY