Concept explainers
The bacterial insertion sequence IS
a. If a mutation reduced the transcriptional efficiency of POUT so as to be equal to that of PIN, what is the likely effect on the transposition of IS
b. If a mutation of PIN eliminates its ability to function in transcription, what is the likely effect on the transposition of IS
Want to see the full answer?
Check out a sample textbook solutionChapter 12 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forward5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…arrow_forward1. enzymes that catalyze histone acetlation are closesly associated with transription factors, which are proteins that promote transcription. why is this a good biochemical strategy? 2. sp1 is a sqeuence specific human DNA binding protein that binds to a region on the DNA called the GC box, a promoter element with the sequence GGGCGG. Binding of Sp1 to the GC box enhances RNA polymerase 2 activity 50- to a 100 fold. How would you use affinity chromatography to purify SP1?arrow_forward
- Predict the state of transcription activation in the following scenarios: A. Regulated as usual B. Higher levels of transcription C. Lower levers of transcription Everything in the system is intact except activators can no longer bind to chromatin modifiers Everything in the system is intact except there are overly active histone deacetylases Everything in the system is intact except heterochromatin is constantly shifted to the form of euchromatin Everything in the system is intact except the main coactivator Mediator no longer binds to RNA Polymerase IIarrow_forward"Upstream" "Downstream" Exons Start of transcription Termination codon 5 3' Promoter initiator codon Introns Polyadenylation signal (intervening sequences) 5' untranslated region 3' untranslated region Direction of transcription Please study the diagram above on eukaryotic gene expression. In order to provide instructions for gene expression, a eukaryotic gene should have the following sequences except for O A. Promoter B. Start codon also known as initiator codon C. Splicing signals (dinucleotide sequence in the intron) O D. 5' CAP sequencearrow_forward. The tac promoter, an artificial promoter made from a chemically syn- thesized oligonucleotide, has been introduced into a plasmid. It is a hybrid of the lac and trp promoters, containing the – 35 region of one and the – 10 region of the other. This promoter directs transcription initiation more efficiently than either the trp or lac promoters. Why?arrow_forward
- Identify the DNA elements and protein factors, #1-7, in the figure below that are involved in the initiation and elongation of transcription at a eukaryotic promoter of a gene TRANSCRIPTION ON RNA PROCESSING PefA A eukaryotic promoter commonly includes a TATA box (a nucleotide sequence TRANSLATION Ritoom containing TATA) about 25 nucleotides upstream from Nontemplate (coding) strand of DNA 7 Pupeptide 1 the transcriptional start point. Nontemplate (coding or sense) strand DNA TATAAAA ATATILTI 5 2 3 Start point 2 Several transcription TCCAA 3' 5' factors, one recognizing the TATA box, must bind 3' end to the DNA before RNA 4 polymerase Il can bind in the correct position and orientation. UCCA 3 5' 3' 3 Additional transcription GGTT factors (purple) bind to the DNA along with RNA 5' Direction of transcription polymerase II, forming the transcription initiation 3 complex. RNA polymerase Il then unwinds the DNA double helix, and RNA synthesis begins at the start point on the temple strand.…arrow_forwardMany promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?arrow_forward5' 3' ORF for gene X The sequence for gene X above has a hypomorphic mutation (which you name Mutation #1) that is not indicated on the diagram. Based on the experimental data below, what specific sequence element is the mutation most likely in? Wild Type Northern Gene X O -10 region O 3' of the ORF ribosome binding site O -35 region Mutant O within the ORF Wild Type Western Gene X direction of transcription Mutant 3' +1 5'arrow_forward
- 1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…arrow_forwarda. How do bacteria increase the efficiency of gene expression? Is this possible in eukaryotes? b. A mutation in the promoter of Gene K disrupts an enzyme binding site and results in the loss of Gene K expression. Is this change in gene expression likely happening at the transcriptional or the translational level? Explain. c. Propose three different mutations to prevent initiation, elongation, and termination of bacterial transcription, respectively. Explain how/why each mutation would prevent its respective step. (Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)arrow_forwardEditing during DNA replication is provided by DNA polymerase enzymatic activity of O 5'-> 3' polymerase 3'-> 5' polymerase O 3'-> 5' exonuclease O an extra enzyme that binds to DNA polymerase O 5'-> 3'exonucleasearrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning