![Genetics: Analysis and Principles](https://www.bartleby.com/isbn_cover_images/9781259616020/9781259616020_largeCoverImage.gif)
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 3EQ
Summary Introduction
To review:
The use of EMSA(electrophoretic mobility shift assay) to study the binding of proteins to a segment of DNA(deoxyribonucleic acid).
Introduction:
EMSA is a technique widely used to identify the DNA or RNA(ribonucleic acid) binding protein. EMSA is also known as gel retardation assay. EMSA helps to study the interaction between protein and rRNA(ribosomal RNA). It also helps in detecting the interaction between transcription factor and DNA regulatory protein and between RNA binding proteins and mRNAs.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?
What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER)
similar and/or different from each other?
Select the correct response:
The NER pathway is the only one that can remove DNA lesions in the strand regardless of
their size which is followed by attaching the correct strand, then sealed by a DNA ligase.
They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments
and proceed with repairing the faulty base in the strand. They differ NER only repairs purine
bases while BER repairs pyrimidine bases.
They both remove the damaged parts of the DNA where the BER pathway corrects only the
identified damaged bases which are usually non-bulky lesions. The NER pathway, on the
other hand, repairs the damage by removal of bulky DNA adducts which is a short-single
stranded DNA segment.
They both utilize the enzyme photolyase to reverse the damages created by the faulty section
of the DNA.
They both remove the damaged parts of the…
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.)
2. b) Is the top or bottom DNA strand the template strand?
Chapter 12 Solutions
Genetics: Analysis and Principles
Ch. 12.1 - 1. Which of the following base sequences is used...Ch. 12.1 - Prob. 2COMQCh. 12.2 - With regard to a promoter, a transcriptional start...Ch. 12.2 - Prob. 2COMQCh. 12.2 - 3. Sigma factor is needed during which stage(s) of...Ch. 12.2 - A uracil-rich sequence occurs at the end of the...Ch. 12.3 - Which RNA polymerase in eukaryotes is responsible...Ch. 12.3 - Prob. 2COMQCh. 12.3 - Prob. 3COMQCh. 12.3 - Prob. 4COMQ
Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently linked to agarose beads to make an affinity column. The beads were incubated with a nuclear extract and the protein:beads became phosphorylated. More nuclear extract was run over the column repeatedly and then the beads were washed extensively. The bound proteins were eluted from the column and when they were separated on a SDS-PAGE gel many bands appeared. What cellular process(es) might these proteins be involved in? Options: splicing polyadenylation DNA replication a and b only a, b and carrow_forwardYou have used the technique of chromatin immunoprecipitation to isolate DNA fragments containing a DNA-binding protein of interest. Suppose that you wish to know whether a particular known DNA fragment is present in the isolated mixture. How might you detect its presence?arrow_forwardIn Noll’s experiment , explain where DNase I cuts the DNA. Why were the bands on the gel in multiples of 200 bp at lower DNase I concentrations?arrow_forward
- A purified recombinant protein is analyzed for molecular weight by SDS-PAGE at pH 8.5. From the protein sequence deduced from the gene that was expressed in bacteria, the protein is expected to have a molecular weight of 44,000. However, the molecular weight of the protein is found by SDS-PAGE to be 52,000. Explain the reason or reasons for this difference in molecular weight. What calculation could you make to help explain this discrepancy?arrow_forwardproteins can interact with DNA through relatively weak forces, such as hydrogen bonds and can der Waals interaction, as well as through stronger electrostatic interactions such as ion pairs. Which types of interaction predominate for sequence specifics DNA binding proteins and for sequence independent binding proteins?arrow_forwardIn cells, certain hormones, such as epinephrine, have the ability to raise the concentration of cAMP. The CREB protein can be found in a cell extract that has been pretreated with epinephrine or not, depending on your preference.Using an electrophoretic mobility shift experiment, you test the CREB protein's capacity to attach to a DNA fragment containing a cAMP response element (CRE). Specify what you hope to achieve.arrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardDuring agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forward
- Both protein and DNA are run together in an isoelectric focusing (IEF) electrophoresis using the immobilised pH gradient (IPG) strip with pH range of 4-7. After the electrophoresis and staining, only ONE band is observed on the middle of the IPG strip. The band is a protein band. Briefly explain why only the protein band and NOT the DNA band appear on the IPG strip.arrow_forwardWhen proteins are separated using native gel electrophoresis, size, shape, and charge control their rate of migration on the gel. Why does DNA separate based on size, and why do we not worry much about shape or charge?arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License