CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
3rd Edition
ISBN: 9780136811206
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 12TYU
FOCUS ON EVOLUTION
Some bacteria may be able to respond to environmental stress by increasing the rate at which mutations occur during cell division. How might this be accomplished? Might there be an evolutionary advantage of this ability? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
1)
Where in the heck did Class I transposons originate?
a
DNA mutations.
b
Bacteria.
c
Prophages.
d
Retroviruses.
2)
What do you think about humans only having about 22,500 genes but we contain about 100,000 proteins?!
a
The production of quaternary shape in proteins can contribute to protein variation.
b
That's the work of the spliceosome!
c
Post-translation modifications in the Golgi Apparatus are responsible for some of that.
d
All the answers are correct.
. Early in development, most human cells turn off expression of an essential component of telomerase, the enzyme responsible for addition of telomere repeat sequences (5’-TTAGGG) to the ends of chromosomes. Thus, as our cells proliferate their telomeres get shorter and shorter, but are normally not lost over the course of a lifetime. If cells are removed from the body and grown in culture, however they ultimately enter a state of replicative senescence and stop dividing when their telomeres get too short. By contrast, most human tumor cells express active telomerase, allowing them to maintain their telomeres and grow beyond the normal limit imposed by senescence - good for them, bad for us.
Anticipating a universal cure for cancer, you set up a company to screen chemical ‘libraries’ for telomerase inhibitors. The company share price takes a dive, however, when a rival group generates a strain of telomerase-knockout mice. These mice breed happily for several generations, but…
3.What could mutation m1 do to the rate of transcription?
Increase? Decrease? Have no effect?
decrease
4.What would mutation m2 do to the length of the primary RNA
transcript for this gene? Increase? Decrease? Have no effect?
have no effect
5.What would mutation m2 do to the length of the MRNA
transcript for this gene? Increase? Decrease? Have no effect?
increase
6.What would mutation m3 do to the length of the primary RNA
transcript for this gene? Increase? Decrease? Have no effect?
have no effect
7.What could mutation m3 do to the function of this protein?
Change it? Have no effect? change it
8.What effect would mutation m4 have on the degradation rate of
the MRNA transcript? Increase it? Decrease it? Have no effect?
decrease
Chapter 13 Solutions
CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
Ch. 13.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 13.1 - Prob. 2CCCh. 13.2 - What role does base pairing play in the...Ch. 13.2 - Make a table listing the functions of seven...Ch. 13.2 - MAKE CONNECTIONS What is the relationship between...Ch. 13.3 - Describe the structure of a nucleosome, the basic...Ch. 13.3 - What two properties, one structural and one...Ch. 13.4 - Prob. 1CCCh. 13.4 - DRAW IT One strand of a DNA molecule has the...Ch. 13.4 - Describe the role of complementary base pairing...
Ch. 13 - In his work with pneumonia-causing bacteria and...Ch. 13 - Prob. 2TYUCh. 13 - In analyzing the number of different bases in a...Ch. 13 - The elongation of the leading strand during DNA...Ch. 13 - Prob. 5TYUCh. 13 - Prob. 6TYUCh. 13 - Prob. 7TYUCh. 13 - Prob. 8TYUCh. 13 - Prob. 9TYUCh. 13 - MAKE CONNECTIONS Although the proteins that cause...Ch. 13 - Prob. 11TYUCh. 13 - FOCUS ON EVOLUTION Some bacteria may be able to...Ch. 13 - FOCUS ON ORGANIZATION The continuity of life is...Ch. 13 - Prob. 14TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
6. How can you use the features found in each chapter?
Human Anatomy & Physiology
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
Some species of bacteria that live at the surface of sediment on the bottom of lakes are capable of using eithe...
Biology: Life on Earth with Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?arrow_forwardHuman Biology- MILESTONE 6 X P genetics-and-biotechnology-glo O https://app.sophia.org/spcc/human-biology-2-mile -> Sophia Pathways M Gmail Purdue Global - Sig... Welcome - Login.gov UNIT 6 – MILESTONE 6 Which of the following is a gene abnormality in which two nonhomologous parts rearrange and fuse together? O Translocation O Deletion None of these, O Duplication SAVE & CONTINUE Report an issue with this question Type here to searcharrow_forwardA gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)arrow_forward
- There are close to 200 different cell types in the human body. Why do they look and function differently from one another? O They each express a different set of genes O They each express all the same genes, but in a different order at different times O They each have slightly different genomes O They all express the same genes, but proteins that aren't needed in a particular cell type are degraded before they can function QUESTION 10 When you exercise, you typically start breathing harder. This is because: O You are switching from aerobic to anaerobic respiration O More oxygen is needed to meet the increased ATP demand O Carbon dioxide stores are quickly depleted during exercise Muscle cells can only use aerobic respirationarrow_forwardQ1: Why is an insertion or a deletion in a gene more likely to alter the protein product than a substitution, such as A for C, would? Q2: Which would you expect to have more impact on an organism: a point mutation as shown here, or the insertion or deletion of a whole chromosome (discussed in Chapter 8)? Q3: Which mechanisms in a cell prevent mutations?arrow_forwardScenario 3 Linda just turned 73 years old, and her doctor has diagnosed her with Alzheimer's disease. Although her family does not have a history of the disease, her children insisted that Linda get tested for genetic mutations related to Alzheimer's disease. The results showed that she does not have any mutations known to cause Alzheimer's disease. 1. How can you explain that Linda has Alzheimer's disease but she does not have any mutations linked to the disease nor a family history of it?arrow_forward
- 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).arrow_forwardWhich of the following statements regarding mutation is FALSE? Question options: mutations typically occur during the production or repair of DNA mutations involve changes in DNA sequence mutations in somatic cells of multicellular organisms are passed to offspring through sexual reproduction mutations may be due to mistakes in normal biological processes such as DNA replication mutations can be caused by certain environmental agents ALL of these statements are TRUE An alteration in the DNA sequence of a gene that alters the amino acid sequence of the encoded polypeptide but does NOT alter the function of this polypeptide is defined as a(n) ________ mutation. Question options: frameshift missense NONE of these terms accurately completes this sentence silent neutral nonsensearrow_forwardWhat type of mutation is this? 1. Which type of mutation is responsible for new varia tions of a trait? Which type of mutation does not result in an abnormal amino acid sequece? Which type of mutation stops the translation of an mRNA molecule? 2. Sickle Cell Anemia Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule Hemoglobin carries oxygen in your red bloods cells. The mutation causes these red blood cells to become stife sickle-shaped when they release their oxygen. The sickled cells tend to get stuck in blood vessels, causing poin ond increased risk of stroke, blindness, damage to the heart & lungs, and other conditions. Analyze the DNA strands below to determine what amino acid is changed AND what type of mutation occurred Normal hemoglobin DNA A G TC Normal hemoglobin mRNA val• Hisolelo thr•proo Gll Normal hemoglobin AA sequence CA cGT AG A CTGAGG AC AC Sickle cell hemoglobin DNA Sickle cell hemoglobin mRNA Sickle cell…arrow_forward
- 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promoterarrow_forward* Google Translate x + re.com/courses/49703/quizzes/244266/take/questions/5315835 Understanding BAC-23 better might be the difference in curing cancer and saving millions of lives! You must sequence its genome and find the genetic code that makes the cancer curing protein. After running several tests, you have found the correct gene segment to be: GGG UCG ACA CUC UUU. Remember that bacteria are weird and their genes are made from a single strand with ribose sugar backbones! 1. Give the correct DNA template for this bacterial gene segment (GGG UCG ACA CUC UUU). ***Please use the following format or it will be marked incorrect*** Example: ABC DEF GHI JKL MNO, all caps, organized in threes with a space in between. Please make my life easier 2. Using the genetic code provided (GGG UCG ACA CUC UUU), translate this gene segment. ***Please use the following format or it will be marked incorrect*** Example: ABC DEF GHI JKL MNO, all caps, organized in threes with a space in between. Please make…arrow_forwardIn 2005, researcher Woo-suk Hwang reported that he had made immortal stem cells from human patients. His research was hailed as a breakthrough for people affected by degenerative diseases, because stem cells may be used to repair a persons own damaged tissues. Hwang published his results in a peer-reviewed journal. In 2006, the journal retracted his paper after other scientists discovered that Hwangs group had faked their data. Does the incident show that results of scientific studies cannot be trusted? Or does it confirm the usefulness of a scientific approach, because other scientists discovered and exposed the fraud?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license